Incidental Mutation 'R6837:Tmem161b'
ID537912
Institutional Source Beutler Lab
Gene Symbol Tmem161b
Ensembl Gene ENSMUSG00000035762
Gene Nametransmembrane protein 161B
Synonyms2810446P07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6837 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location84222296-84296141 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to A at 84222418 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057495] [ENSMUST00000223827] [ENSMUST00000223862] [ENSMUST00000224525] [ENSMUST00000225069]
Predicted Effect probably benign
Transcript: ENSMUST00000057495
SMART Domains Protein: ENSMUSP00000055208
Gene: ENSMUSG00000035762

DomainStartEndE-ValueType
Pfam:Tmemb_161AB 2 485 1.3e-213 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185973
Predicted Effect probably benign
Transcript: ENSMUST00000223827
Predicted Effect probably benign
Transcript: ENSMUST00000223862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224501
Predicted Effect probably benign
Transcript: ENSMUST00000224525
Predicted Effect probably benign
Transcript: ENSMUST00000225069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225212
Meta Mutation Damage Score 0.0312 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (41/42)
MGI Phenotype PHENOTYPE: Homozygous mice exhibit lethality before genotyping age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 G A 12: 53,141,262 E1820K probably damaging Het
Anxa8 A T 14: 34,092,554 I116F probably damaging Het
Arid4a A G 12: 71,075,515 D890G probably benign Het
Aup1 C T 6: 83,057,298 T396I possibly damaging Het
C2cd3 G C 7: 100,448,746 E594Q probably damaging Het
Colgalt2 C T 1: 152,506,828 P477L probably damaging Het
D11Wsu47e A G 11: 113,688,613 H278R possibly damaging Het
Dennd3 G A 15: 73,557,693 D20N probably damaging Het
Dpysl3 A G 18: 43,437,882 I109T probably benign Het
Fas A T 19: 34,307,164 T24S probably damaging Het
Fras1 A T 5: 96,726,973 I2332F probably damaging Het
Gm10267 T C 18: 44,158,308 H32R probably benign Het
Hcfc2 A T 10: 82,739,196 I230F probably damaging Het
Hdac9 T C 12: 34,287,464 T673A probably benign Het
Herc2 T G 7: 56,189,841 N3366K possibly damaging Het
Hhla1 T C 15: 65,948,485 N139D probably damaging Het
Hip1r A G 5: 123,998,865 E632G possibly damaging Het
Kcnc2 A G 10: 112,458,502 D98G probably damaging Het
Maip1 T A 1: 57,415,732 *292K probably null Het
Map2 T C 1: 66,414,572 F874L probably damaging Het
Myof A T 19: 37,922,956 probably null Het
Notch2 A G 3: 98,070,854 probably null Het
Npy5r T A 8: 66,681,740 M134L probably benign Het
Ntsr2 T A 12: 16,659,709 M225K probably benign Het
Nup153 G A 13: 46,694,051 T634I probably damaging Het
Olfr583 T A 7: 103,051,722 Y141* probably null Het
Pcsk5 T C 19: 17,439,084 S1667G probably benign Het
Pex13 A G 11: 23,649,527 I328T possibly damaging Het
Pkd2 T G 5: 104,477,043 L235W probably damaging Het
Prune2 A T 19: 17,178,928 D66V probably damaging Het
Rasal3 T C 17: 32,403,070 N105S probably benign Het
Sla A T 15: 66,787,090 I144N probably damaging Het
Slc5a4b A T 10: 76,062,386 I498N possibly damaging Het
Snx14 C T 9: 88,380,223 E872K probably benign Het
Stx16 G A 2: 174,094,002 R242H probably benign Het
Tg T C 15: 66,696,135 F1296S probably damaging Het
Tmf1 G A 6: 97,176,581 T177M possibly damaging Het
Tuba4a T C 1: 75,217,394 Q14R probably damaging Het
Vmn2r114 T C 17: 23,310,202 M309V probably benign Het
Vps13c C T 9: 67,910,222 P1059S probably benign Het
Yars T A 4: 129,209,751 S298T possibly damaging Het
Other mutations in Tmem161b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Tmem161b APN 13 84294596 splice site probably benign
IGL01086:Tmem161b APN 13 84222422 utr 5 prime probably benign
IGL01150:Tmem161b APN 13 84292407 nonsense probably null
IGL01566:Tmem161b APN 13 84294762 missense probably benign 0.35
IGL02183:Tmem161b APN 13 84272254 missense probably damaging 1.00
IGL02481:Tmem161b APN 13 84283993 missense probably damaging 0.99
IGL02519:Tmem161b APN 13 84294744 missense probably damaging 1.00
IGL03207:Tmem161b APN 13 84294595 splice site probably benign
R0015:Tmem161b UTSW 13 84222414 utr 5 prime probably null
R0376:Tmem161b UTSW 13 84292383 missense probably benign 0.43
R0613:Tmem161b UTSW 13 84251320 missense probably damaging 1.00
R1925:Tmem161b UTSW 13 84260229 missense probably benign 0.07
R1935:Tmem161b UTSW 13 84293466 missense probably damaging 1.00
R1936:Tmem161b UTSW 13 84293466 missense probably damaging 1.00
R2325:Tmem161b UTSW 13 84294768 missense possibly damaging 0.94
R2988:Tmem161b UTSW 13 84292455 nonsense probably null
R4327:Tmem161b UTSW 13 84251240 missense probably damaging 1.00
R4525:Tmem161b UTSW 13 84257802 missense probably benign 0.00
R4558:Tmem161b UTSW 13 84251244 missense possibly damaging 0.50
R5133:Tmem161b UTSW 13 84294768 missense possibly damaging 0.94
R5134:Tmem161b UTSW 13 84294768 missense possibly damaging 0.94
R5727:Tmem161b UTSW 13 84286790 missense possibly damaging 0.63
R5875:Tmem161b UTSW 13 84294858 missense probably damaging 1.00
R6217:Tmem161b UTSW 13 84251244 missense possibly damaging 0.50
R6527:Tmem161b UTSW 13 84272264 missense probably benign 0.06
R6550:Tmem161b UTSW 13 84222418 start gained probably benign
R6551:Tmem161b UTSW 13 84222418 start gained probably benign
R6553:Tmem161b UTSW 13 84222418 start gained probably benign
R6554:Tmem161b UTSW 13 84222418 start gained probably benign
R6640:Tmem161b UTSW 13 84222418 start gained probably benign
R6641:Tmem161b UTSW 13 84222418 start gained probably benign
R6685:Tmem161b UTSW 13 84222418 start gained probably benign
R6836:Tmem161b UTSW 13 84222418 start gained probably benign
R6838:Tmem161b UTSW 13 84222418 start gained probably benign
R7077:Tmem161b UTSW 13 84222418 start gained probably benign
R7078:Tmem161b UTSW 13 84222418 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GGCTTTAGAGAACGCCTTGC -3'
(R):5'- TAGACTGGGTACTCCGACAGAC -3'

Sequencing Primer
(F):5'- TCCTCTCTGCGTGGCGTG -3'
(R):5'- TCCCTCGGCTGTCTGGAAC -3'
Posted On2018-10-18