Incidental Mutation 'R6838:Aim2'
List |< first << previous [record 81 of 1871] next >> last >|
ID537931
Institutional Source Beutler Lab
Gene Symbol Aim2
Ensembl Gene ENSMUSG00000037860
Gene Nameabsent in melanoma 2
SynonymsLOC383619, Ifi210
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.038) question?
Stock #R6838 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location173350879-173466040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 173463980 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 317 (T317R)
Ref Sequence ENSEMBL: ENSMUSP00000132253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147604] [ENSMUST00000160565] [ENSMUST00000166137] [ENSMUST00000173023]
Predicted Effect probably damaging
Transcript: ENSMUST00000147604
AA Change: T317R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119465
Gene: ENSMUSG00000037860
AA Change: T317R

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 322 2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160565
SMART Domains Protein: ENSMUSP00000134646
Gene: ENSMUSG00000037849

DomainStartEndE-ValueType
PYRIN 6 84 5.7e-21 SMART
low complexity region 97 108 N/A INTRINSIC
internal_repeat_1 154 349 6.25e-15 PROSPERO
internal_repeat_1 342 575 6.25e-15 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000166137
AA Change: T317R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132253
Gene: ENSMUSG00000037860
AA Change: T317R

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 321 9.4e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173023
SMART Domains Protein: ENSMUSP00000134329
Gene: ENSMUSG00000037860

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] AIM2 is a member of the IFI20X /IFI16 family. It plays a putative role in tumorigenic reversion and may control cell proliferation. Interferon-gamma induces expression of AIM2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit increased susceptibility to bacterial and viral infections with altered cytokine production and inflammatory cell death (pyrotosis). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqp9 T A 9: 71,112,216 M321L probably benign Het
Avil G A 10: 127,013,562 D576N probably benign Het
Bbs1 C T 19: 4,903,852 M94I possibly damaging Het
BC052040 T C 2: 115,776,990 F275L possibly damaging Het
Bms1 A G 6: 118,416,494 V139A probably benign Het
Bscl2 A T 19: 8,841,381 M57L probably damaging Het
C2cd5 A G 6: 143,029,638 I794T possibly damaging Het
C530008M17Rik A T 5: 76,858,209 T806S unknown Het
Cacna1s C T 1: 136,084,437 T539I possibly damaging Het
Cand1 T C 10: 119,210,030 K990R probably benign Het
Capn7 A G 14: 31,354,173 I311V possibly damaging Het
Cd180 A G 13: 102,702,731 N41D probably benign Het
Celsr1 G A 15: 85,939,194 T1671I probably benign Het
Cep135 A T 5: 76,632,215 Q798L probably damaging Het
Cfap65 T C 1: 74,932,021 D46G probably benign Het
Ddx46 G T 13: 55,639,935 probably null Het
Dnah7b T C 1: 46,191,788 L1402P probably damaging Het
Dnah8 A G 17: 30,710,551 E1402G probably damaging Het
Dock9 A G 14: 121,546,596 Y1989H possibly damaging Het
Ereg A G 5: 91,088,464 D50G probably benign Het
Evi5 G T 5: 107,842,161 T64K possibly damaging Het
Frem3 A C 8: 80,612,031 T318P probably damaging Het
Gm8693 T A 7: 22,691,717 M201L probably benign Het
Gpx1 A G 9: 108,339,940 D81G possibly damaging Het
Gramd1a T C 7: 31,134,504 I499V probably benign Het
Herc2 T A 7: 56,108,778 D804E probably damaging Het
Hist1h4k A T 13: 21,750,205 F101I probably damaging Het
Hk1 T C 10: 62,271,658 E846G probably damaging Het
Iars2 G A 1: 185,329,145 A48V probably damaging Het
Invs C T 4: 48,283,278 T10M possibly damaging Het
Ism2 A T 12: 87,280,201 D321E probably benign Het
Itpr1 T C 6: 108,471,191 S231P possibly damaging Het
Kif17 A T 4: 138,278,399 probably null Het
Lvrn A G 18: 46,890,880 I765V possibly damaging Het
Map4k4 T A 1: 39,976,722 C108S probably damaging Het
Mapk13 G T 17: 28,777,561 probably null Het
Mapkapk2 T A 1: 131,058,003 K95* probably null Het
Mau2 A T 8: 70,039,297 probably null Het
Mex3a A G 3: 88,536,777 T387A probably benign Het
Myo5a T C 9: 75,153,883 probably null Het
Ncbp3 A T 11: 73,073,474 M417L possibly damaging Het
Nod2 A C 8: 88,670,458 E810A possibly damaging Het
Nol3 A T 8: 105,279,575 E152V probably damaging Het
Obox6 T C 7: 15,833,739 E261G possibly damaging Het
Olfr875 A C 9: 37,773,052 Y131S possibly damaging Het
Olfr91 A T 17: 37,093,166 L236* probably null Het
P3h2 T C 16: 26,105,284 S134G possibly damaging Het
Plxna2 A T 1: 194,804,914 R1592S possibly damaging Het
Ppp1r12a C T 10: 108,261,276 S250L possibly damaging Het
Rab38 A G 7: 88,450,709 D144G possibly damaging Het
Sept1 T C 7: 127,216,722 M176V probably benign Het
Spata22 C T 11: 73,345,933 T355M probably benign Het
Tango6 A G 8: 106,742,074 N734S probably benign Het
Tbc1d17 C A 7: 44,844,314 R295L probably damaging Het
Thsd7a G T 6: 12,504,075 P360Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnnt1 T C 7: 4,507,407 N239S possibly damaging Het
Tpst1 A T 5: 130,102,438 M250L probably benign Het
Urb1 T A 16: 90,782,106 D689V possibly damaging Het
Usp28 T A 9: 49,000,430 probably null Het
Vldlr G A 19: 27,247,970 D816N probably damaging Het
Wdr1 A G 5: 38,530,031 V219A probably damaging Het
Xndc1 T C 7: 102,073,269 V47A possibly damaging Het
Zfp366 C T 13: 99,228,507 P59S possibly damaging Het
Zfp366 A G 13: 99,246,177 E616G possibly damaging Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Other mutations in Aim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Aim2 APN 1 173455465 missense probably benign 0.23
IGL01086:Aim2 APN 1 173455433 missense probably damaging 0.99
IGL02292:Aim2 APN 1 173462274 missense probably benign 0.05
IGL02382:Aim2 APN 1 173459749 unclassified probably null
R0226:Aim2 UTSW 1 173462333 unclassified probably benign
R0609:Aim2 UTSW 1 173461964 missense probably damaging 0.98
R1281:Aim2 UTSW 1 173459811 nonsense probably null
R2054:Aim2 UTSW 1 173463982 missense probably damaging 1.00
R2110:Aim2 UTSW 1 173459713 missense probably benign 0.00
R4080:Aim2 UTSW 1 173459851 critical splice donor site probably null
R4081:Aim2 UTSW 1 173459851 critical splice donor site probably null
R4082:Aim2 UTSW 1 173459851 critical splice donor site probably null
R4452:Aim2 UTSW 1 173455444 missense possibly damaging 0.63
R4647:Aim2 UTSW 1 173455524 synonymous silent
R4731:Aim2 UTSW 1 173463876 missense possibly damaging 0.83
R4732:Aim2 UTSW 1 173463876 missense possibly damaging 0.83
R4733:Aim2 UTSW 1 173463876 missense possibly damaging 0.83
R4923:Aim2 UTSW 1 173459806 missense probably benign 0.04
R5009:Aim2 UTSW 1 173455366 missense probably damaging 0.96
R6290:Aim2 UTSW 1 173462115 missense possibly damaging 0.48
R6372:Aim2 UTSW 1 173455236 intron probably null
R6821:Aim2 UTSW 1 173463980 missense probably damaging 1.00
R6836:Aim2 UTSW 1 173463980 missense probably damaging 1.00
X0021:Aim2 UTSW 1 173463919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTCCTAGCTTGTCTGATAAC -3'
(R):5'- AATGACAGGCTTCTCAGGTC -3'

Sequencing Primer
(F):5'- CCTAGCTTGTCTGATAACTGATTG -3'
(R):5'- TCTCAGGTCTGTGAGATGCAAAG -3'
Posted On2018-10-18