Incidental Mutation 'R6838:Avil'
ID537971
Institutional Source Beutler Lab
Gene Symbol Avil
Ensembl Gene ENSMUSG00000025432
Gene Nameadvillin
SynonymsDOC6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R6838 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127000709-127020994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127013562 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 576 (D576N)
Ref Sequence ENSEMBL: ENSMUSP00000123405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026500] [ENSMUST00000129173] [ENSMUST00000152054]
Predicted Effect probably benign
Transcript: ENSMUST00000026500
AA Change: D576N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026500
Gene: ENSMUSG00000025432
AA Change: D576N

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129173
AA Change: D576N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123405
Gene: ENSMUSG00000025432
AA Change: D576N

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152054
SMART Domains Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
Pfam:UBA 44 81 1.2e-10 PFAM
SCOP:d1efub4 101 120 5e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the gelsolin/villin family of actin regulatory proteins. This protein has structural similarity to villin. It binds actin and may play a role in the development of neuronal cells that form ganglia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes null mice show partial embryonic lethality before E10.5, but surviving mice are fertile and exhibit no abnormal behavior into adult. The regenerative axon growth and remodeling of sensory nerves are abnormal in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aim2 C G 1: 173,463,980 T317R probably damaging Het
Aqp9 T A 9: 71,112,216 M321L probably benign Het
Bbs1 C T 19: 4,903,852 M94I possibly damaging Het
BC052040 T C 2: 115,776,990 F275L possibly damaging Het
Bms1 A G 6: 118,416,494 V139A probably benign Het
Bscl2 A T 19: 8,841,381 M57L probably damaging Het
C2cd5 A G 6: 143,029,638 I794T possibly damaging Het
C530008M17Rik A T 5: 76,858,209 T806S unknown Het
Cacna1s C T 1: 136,084,437 T539I possibly damaging Het
Cand1 T C 10: 119,210,030 K990R probably benign Het
Capn7 A G 14: 31,354,173 I311V possibly damaging Het
Cd180 A G 13: 102,702,731 N41D probably benign Het
Celsr1 G A 15: 85,939,194 T1671I probably benign Het
Cep135 A T 5: 76,632,215 Q798L probably damaging Het
Cfap65 T C 1: 74,932,021 D46G probably benign Het
Ddx46 G T 13: 55,639,935 probably null Het
Dnah7b T C 1: 46,191,788 L1402P probably damaging Het
Dnah8 A G 17: 30,710,551 E1402G probably damaging Het
Dock9 A G 14: 121,546,596 Y1989H possibly damaging Het
Ereg A G 5: 91,088,464 D50G probably benign Het
Evi5 G T 5: 107,842,161 T64K possibly damaging Het
Frem3 A C 8: 80,612,031 T318P probably damaging Het
Gm8693 T A 7: 22,691,717 M201L probably benign Het
Gpx1 A G 9: 108,339,940 D81G possibly damaging Het
Gramd1a T C 7: 31,134,504 I499V probably benign Het
Herc2 T A 7: 56,108,778 D804E probably damaging Het
Hist1h4k A T 13: 21,750,205 F101I probably damaging Het
Hk1 T C 10: 62,271,658 E846G probably damaging Het
Iars2 G A 1: 185,329,145 A48V probably damaging Het
Invs C T 4: 48,283,278 T10M possibly damaging Het
Ism2 A T 12: 87,280,201 D321E probably benign Het
Itpr1 T C 6: 108,471,191 S231P possibly damaging Het
Kif17 A T 4: 138,278,399 probably null Het
Lvrn A G 18: 46,890,880 I765V possibly damaging Het
Map4k4 T A 1: 39,976,722 C108S probably damaging Het
Mapk13 G T 17: 28,777,561 probably null Het
Mapkapk2 T A 1: 131,058,003 K95* probably null Het
Mau2 A T 8: 70,039,297 probably null Het
Mex3a A G 3: 88,536,777 T387A probably benign Het
Myo5a T C 9: 75,153,883 probably null Het
Ncbp3 A T 11: 73,073,474 M417L possibly damaging Het
Nod2 A C 8: 88,670,458 E810A possibly damaging Het
Nol3 A T 8: 105,279,575 E152V probably damaging Het
Obox6 T C 7: 15,833,739 E261G possibly damaging Het
Olfr875 A C 9: 37,773,052 Y131S possibly damaging Het
Olfr91 A T 17: 37,093,166 L236* probably null Het
P3h2 T C 16: 26,105,284 S134G possibly damaging Het
Plxna2 A T 1: 194,804,914 R1592S possibly damaging Het
Ppp1r12a C T 10: 108,261,276 S250L possibly damaging Het
Rab38 A G 7: 88,450,709 D144G possibly damaging Het
Sept1 T C 7: 127,216,722 M176V probably benign Het
Spata22 C T 11: 73,345,933 T355M probably benign Het
Tango6 A G 8: 106,742,074 N734S probably benign Het
Tbc1d17 C A 7: 44,844,314 R295L probably damaging Het
Thsd7a G T 6: 12,504,075 P360Q probably damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnnt1 T C 7: 4,507,407 N239S possibly damaging Het
Tpst1 A T 5: 130,102,438 M250L probably benign Het
Urb1 T A 16: 90,782,106 D689V possibly damaging Het
Usp28 T A 9: 49,000,430 probably null Het
Vldlr G A 19: 27,247,970 D816N probably damaging Het
Wdr1 A G 5: 38,530,031 V219A probably damaging Het
Xndc1 T C 7: 102,073,269 V47A possibly damaging Het
Zfp366 C T 13: 99,228,507 P59S possibly damaging Het
Zfp366 A G 13: 99,246,177 E616G possibly damaging Het
Zfp937 T A 2: 150,239,346 I432K probably benign Het
Other mutations in Avil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Avil APN 10 127017034 critical splice donor site probably null
IGL01893:Avil APN 10 127020546 missense possibly damaging 0.73
IGL02127:Avil APN 10 127011826 missense probably benign 0.13
IGL02425:Avil APN 10 127018447 missense probably benign
IGL02458:Avil APN 10 127016353 missense probably benign 0.00
IGL02707:Avil APN 10 127006562 missense probably damaging 1.00
IGL02805:Avil APN 10 127007617 missense possibly damaging 0.79
IGL02836:Avil APN 10 127008995 missense probably damaging 1.00
IGL02961:Avil APN 10 127008306 missense probably benign 0.00
IGL03025:Avil APN 10 127013577 missense probably benign 0.19
IGL03083:Avil APN 10 127016324 missense probably benign 0.31
IGL03345:Avil APN 10 127008957 unclassified probably benign
IGL03365:Avil APN 10 127010983 missense probably damaging 1.00
R0109:Avil UTSW 10 127013644 missense probably benign
R0109:Avil UTSW 10 127013644 missense probably benign
R1159:Avil UTSW 10 127011790 missense possibly damaging 0.94
R1631:Avil UTSW 10 127010625 unclassified probably null
R2026:Avil UTSW 10 127011873 missense probably damaging 1.00
R3694:Avil UTSW 10 127008330 missense probably damaging 0.98
R3948:Avil UTSW 10 127014205 missense probably benign 0.00
R4165:Avil UTSW 10 127006627 nonsense probably null
R4978:Avil UTSW 10 127018396 missense probably benign 0.09
R5159:Avil UTSW 10 127020448 critical splice acceptor site probably null
R5254:Avil UTSW 10 127011761 missense probably benign 0.01
R5285:Avil UTSW 10 127018459 missense probably damaging 0.97
R5618:Avil UTSW 10 127010577 missense possibly damaging 0.79
R5682:Avil UTSW 10 127014104 missense probably damaging 1.00
R5786:Avil UTSW 10 127016499 critical splice donor site probably null
R5819:Avil UTSW 10 127009998 missense probably damaging 1.00
R6149:Avil UTSW 10 127006582 missense probably benign 0.25
R6631:Avil UTSW 10 127007749 missense possibly damaging 0.52
R6665:Avil UTSW 10 127020525 missense probably damaging 1.00
R6745:Avil UTSW 10 127014119 missense probably benign 0.00
R6804:Avil UTSW 10 127008306 nonsense probably null
R7481:Avil UTSW 10 127007591 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ACTGTGGGTTTCAGAGCAGG -3'
(R):5'- GAATGTTTAAAGCTGTGAGGGAATC -3'

Sequencing Primer
(F):5'- TCAGAGCAGGCCTGTCCTTTG -3'
(R):5'- ATCTCAGGATTTGTAGGGACCAC -3'
Posted On2018-10-18