Incidental Mutation 'R6436:Pdcd4'
ID538068
Institutional Source Beutler Lab
Gene Symbol Pdcd4
Ensembl Gene ENSMUSG00000024975
Gene Nameprogrammed cell death 4
SynonymsMA-3, D19Ucla1, TIS
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R6436 (G1)
Quality Score57.0073
Status Validated
Chromosome19
Chromosomal Location53892231-53929861 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 53926931 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025931] [ENSMUST00000074371] [ENSMUST00000165617]
Predicted Effect probably null
Transcript: ENSMUST00000025931
SMART Domains Protein: ENSMUSP00000025931
Gene: ENSMUSG00000024975

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
low complexity region 96 122 N/A INTRINSIC
MA3 164 275 3.68e-41 SMART
MA3 327 440 5.01e-43 SMART
Predicted Effect probably null
Transcript: ENSMUST00000074371
SMART Domains Protein: ENSMUSP00000073975
Gene: ENSMUSG00000024975

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
low complexity region 96 122 N/A INTRINSIC
MA3 164 275 3.68e-41 SMART
MA3 327 440 5.01e-43 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165617
SMART Domains Protein: ENSMUSP00000133135
Gene: ENSMUSG00000024975

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
low complexity region 96 122 N/A INTRINSIC
MA3 164 275 3.68e-41 SMART
MA3 327 440 5.01e-43 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.1%
  • 20x: 93.5%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a tumor suppressor and encodes a protein that binds to the eukaryotic translation initiation factor 4A1 and inhibits its function by preventing RNA binding. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a null allele have a higher prevalence of B cell derived lymphomas, multi-organ cysts and decreased susceptibility to experimentally induced autoimmune encephalomyelitis and type 1 diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arc C A 15: 74,672,249 V42L possibly damaging Het
Clip1 C T 5: 123,641,785 E433K probably damaging Het
Cmya5 T C 13: 93,089,215 T3122A probably damaging Het
Ctf2 G T 7: 127,719,431 A92E probably damaging Het
Ctsw G T 19: 5,466,294 R184S possibly damaging Het
D130043K22Rik A G 13: 24,877,935 E629G probably damaging Het
Dmbt1 T C 7: 131,116,641 V1523A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fanci T C 7: 79,440,698 I982T probably benign Het
Fnbp1 T C 2: 31,096,127 D3G probably damaging Het
Gm10770 G A 2: 150,178,910 T229I probably benign Het
Gm35315 G A 5: 110,078,712 T287I probably benign Het
Itgb3 T A 11: 104,633,492 D151E probably damaging Het
Lcn8 A T 2: 25,654,978 probably null Het
Ninl A G 2: 150,966,178 L310P probably damaging Het
Nop2 A G 6: 125,137,311 D215G probably benign Het
Olfr1426 T C 19: 12,087,935 T286A probably benign Het
Olfr788 A G 10: 129,472,904 T71A probably damaging Het
Parg T C 14: 32,271,677 W289R probably damaging Het
Plk2 G T 13: 110,396,036 E95* probably null Het
Pold1 G A 7: 44,538,778 R559C probably damaging Het
Ptprc T C 1: 138,083,639 D560G possibly damaging Het
Rasal3 T C 17: 32,397,504 Y290C probably damaging Het
Rcsd1 T A 1: 165,657,615 S90C probably damaging Het
Rttn T C 18: 89,110,729 L1935P probably damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Srsf11 C T 3: 158,023,344 probably benign Homo
Tmc3 T C 7: 83,598,487 Y230H probably damaging Het
Tnfrsf25 A T 4: 152,119,627 probably null Het
Ubl7 T C 9: 57,920,510 L160P probably damaging Het
Vmn2r106 C T 17: 20,268,463 C558Y probably damaging Het
Zfp646 T A 7: 127,879,941 V430E probably benign Het
Other mutations in Pdcd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Pdcd4 APN 19 53929121 missense probably benign
IGL02608:Pdcd4 APN 19 53927207 unclassified probably null
seventh UTSW 19 53922133 critical splice donor site probably null
R0893:Pdcd4 UTSW 19 53929094 missense probably damaging 1.00
R1437:Pdcd4 UTSW 19 53909243 missense probably damaging 0.99
R1836:Pdcd4 UTSW 19 53926219 missense probably damaging 1.00
R4298:Pdcd4 UTSW 19 53919661 missense probably damaging 1.00
R6365:Pdcd4 UTSW 19 53922133 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGGTCTATGCCTCCTTTAGC -3'
(R):5'- GTGCAACCTGGCAAAACAAGTC -3'

Sequencing Primer
(F):5'- TGCCTCCTTTAGCTATATAAGAGTTG -3'
(R):5'- CAACCTGGCAAAACAAGTCATATTTG -3'
Posted On2018-10-19