Incidental Mutation 'R6893:Fastkd2'
ID538138
Institutional Source Beutler Lab
Gene Symbol Fastkd2
Ensembl Gene ENSMUSG00000025962
Gene NameFAST kinase domains 2
Synonyms2810421I24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6893 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location63730614-63754655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63731794 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 103 (A103V)
Ref Sequence ENSEMBL: ENSMUSP00000027103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027103] [ENSMUST00000114094]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027103
AA Change: A103V

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027103
Gene: ENSMUSG00000025962
AA Change: A103V

DomainStartEndE-ValueType
low complexity region 310 323 N/A INTRINSIC
Pfam:FAST_1 443 512 2.3e-23 PFAM
low complexity region 546 557 N/A INTRINSIC
RAP 619 675 1.66e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114094
SMART Domains Protein: ENSMUSP00000109728
Gene: ENSMUSG00000025963

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
SCOP:d1b8pa1 131 282 1e-16 SMART
PDB:5MDH|B 131 457 3e-32 PDB
SCOP:d7mdha2 290 454 7e-18 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.7%
  • 20x: 95.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T A 8: 24,878,754 D538V probably damaging Het
Akap9 T C 5: 3,961,709 I804T probably benign Het
Amy1 T C 3: 113,563,632 E186G probably benign Het
Best1 A G 19: 9,997,082 Y33H probably damaging Het
Cacna1s C A 1: 136,077,693 N405K probably benign Het
Casp7 T C 19: 56,433,309 Y60H probably damaging Het
Ccdc61 T C 7: 18,892,563 N367S possibly damaging Het
Cnksr3 A T 10: 7,135,129 probably null Het
Col14a1 A C 15: 55,444,648 probably benign Het
Cyp3a57 A T 5: 145,386,974 K424* probably null Het
Dpep3 T C 8: 105,973,842 K411E probably benign Het
Ebf2 T A 14: 67,237,559 V81E probably benign Het
Ehbp1 G T 11: 22,014,945 T1084K probably damaging Het
Gm13762 A G 2: 88,973,799 F31L probably benign Het
Gtf3c2 T C 5: 31,166,378 K525E probably benign Het
Hdac2 A G 10: 36,997,007 E287G probably damaging Het
Ifi207 T A 1: 173,727,642 T832S possibly damaging Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Lef1 A G 3: 131,115,500 D55G possibly damaging Het
Lipo2 G T 19: 33,721,007 Y323* probably null Het
Mettl24 C T 10: 40,737,798 R178C probably damaging Het
Nat6 A G 9: 107,583,026 E40G probably damaging Het
Ndrg4 C A 8: 95,706,601 C66* probably null Het
Nemf A G 12: 69,352,336 V140A probably benign Het
Nid2 T A 14: 19,789,787 F815I probably benign Het
Olfr1076 A G 2: 86,508,792 E111G probably damaging Het
Olfr1459 A C 19: 13,145,742 S306A probably benign Het
Olfr876 A C 9: 37,804,845 *311C probably null Het
Olfr918 A T 9: 38,673,059 N141K possibly damaging Het
Pcdhga3 T C 18: 37,676,545 S684P probably benign Het
Plch1 A T 3: 63,753,141 C352* probably null Het
Plscr2 G A 9: 92,290,704 V139I probably benign Het
Ppa1 T A 10: 61,672,403 C270S probably benign Het
Ryr2 T A 13: 11,829,654 M399L possibly damaging Het
Scn3a A G 2: 65,525,754 V212A possibly damaging Het
Serpina3b A G 12: 104,133,026 K267E probably benign Het
Shroom3 A G 5: 92,942,204 T938A probably damaging Het
Specc1 A C 11: 62,132,453 S115R probably benign Het
Stim2 C T 5: 54,053,445 T74I probably benign Het
Sult6b2 T A 6: 142,804,299 D31V possibly damaging Het
Tbc1d24 A T 17: 24,182,518 W406R probably damaging Het
Tmprss11b A G 5: 86,663,386 probably null Het
Trappc9 A G 15: 72,925,650 Y575H possibly damaging Het
Trim63 C T 4: 134,323,101 T232M probably damaging Het
Ttn A T 2: 76,767,836 S19578T probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr63 T C 3: 146,080,429 E366G probably damaging Het
Xpo4 T A 14: 57,582,310 E1139D probably benign Het
Other mutations in Fastkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fastkd2 APN 1 63737771 splice site probably benign
IGL01890:Fastkd2 APN 1 63732161 missense probably benign 0.06
IGL02698:Fastkd2 APN 1 63747999 missense probably benign 0.01
IGL02992:Fastkd2 APN 1 63737924 splice site probably benign
IGL03208:Fastkd2 APN 1 63739206 missense probably damaging 1.00
R0172:Fastkd2 UTSW 1 63732028 missense possibly damaging 0.78
R0304:Fastkd2 UTSW 1 63752400 missense possibly damaging 0.46
R0385:Fastkd2 UTSW 1 63737811 missense probably benign 0.01
R0486:Fastkd2 UTSW 1 63752340 missense possibly damaging 0.61
R1115:Fastkd2 UTSW 1 63747955 splice site probably benign
R1468:Fastkd2 UTSW 1 63732226 unclassified probably benign
R1579:Fastkd2 UTSW 1 63745887 missense probably null 0.00
R1729:Fastkd2 UTSW 1 63751300 nonsense probably null
R3937:Fastkd2 UTSW 1 63737836 missense possibly damaging 0.48
R4326:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4327:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4463:Fastkd2 UTSW 1 63735809 intron probably benign
R4473:Fastkd2 UTSW 1 63731674 missense probably damaging 0.97
R4760:Fastkd2 UTSW 1 63745886 missense probably benign 0.00
R5012:Fastkd2 UTSW 1 63749896 intron probably benign
R5176:Fastkd2 UTSW 1 63731439 unclassified probably benign
R5478:Fastkd2 UTSW 1 63739186 missense probably benign 0.13
R5619:Fastkd2 UTSW 1 63739310 missense probably benign 0.25
R7038:Fastkd2 UTSW 1 63731873 missense possibly damaging 0.79
R7049:Fastkd2 UTSW 1 63731850 missense probably benign 0.04
R7510:Fastkd2 UTSW 1 63737789 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CATTGGGAACTTGCAGACCAG -3'
(R):5'- GTGCTTTTGAAAATGTGTCCAGC -3'

Sequencing Primer
(F):5'- GAACTTGCAGACCAGAGGTTATTC -3'
(R):5'- GTGTCCAGCACATCACTCAGAGAG -3'
Posted On2018-11-06