Incidental Mutation 'R6893:Nid2'
ID538175
Institutional Source Beutler Lab
Gene Symbol Nid2
Ensembl Gene ENSMUSG00000021806
Gene Namenidogen 2
Synonymsentactin 2, entactin-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R6893 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location19751265-19811787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19789787 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 815 (F815I)
Ref Sequence ENSEMBL: ENSMUSP00000022340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022340]
Predicted Effect probably benign
Transcript: ENSMUST00000022340
AA Change: F815I

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022340
Gene: ENSMUSG00000021806
AA Change: F815I

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Blast:NIDO 39 77 3e-11 BLAST
NIDO 108 276 1.12e-72 SMART
low complexity region 421 430 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
EGF 510 547 1.84e1 SMART
G2F 548 780 4.36e-143 SMART
EGF 785 823 2.52e-2 SMART
EGF_CA 824 866 1.45e-11 SMART
EGF 874 914 3.15e-3 SMART
EGF_CA 915 953 5.03e-11 SMART
TY 988 1037 8.27e-20 SMART
TY 1068 1116 1.19e-20 SMART
LY 1162 1204 1.15e-5 SMART
LY 1206 1248 8.82e-16 SMART
LY 1249 1293 1.51e-14 SMART
LY 1294 1336 3.56e-11 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.7%
  • 20x: 95.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane proteins. This protein is a cell-adhesion protein that binds collagens I and IV and laminin and may be involved in maintaining the structure of the basement membrane.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a null alleleexhibit calcification of joint cartilage and osteoarthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T A 8: 24,878,754 D538V probably damaging Het
Akap9 T C 5: 3,961,709 I804T probably benign Het
Amy1 T C 3: 113,563,632 E186G probably benign Het
Best1 A G 19: 9,997,082 Y33H probably damaging Het
Cacna1s C A 1: 136,077,693 N405K probably benign Het
Casp7 T C 19: 56,433,309 Y60H probably damaging Het
Ccdc61 T C 7: 18,892,563 N367S possibly damaging Het
Cnksr3 A T 10: 7,135,129 probably null Het
Col14a1 A C 15: 55,444,648 probably benign Het
Cyp3a57 A T 5: 145,386,974 K424* probably null Het
Dpep3 T C 8: 105,973,842 K411E probably benign Het
Ebf2 T A 14: 67,237,559 V81E probably benign Het
Ehbp1 G T 11: 22,014,945 T1084K probably damaging Het
Fastkd2 C T 1: 63,731,794 A103V possibly damaging Het
Gm13762 A G 2: 88,973,799 F31L probably benign Het
Gtf3c2 T C 5: 31,166,378 K525E probably benign Het
Hdac2 A G 10: 36,997,007 E287G probably damaging Het
Ifi207 T A 1: 173,727,642 T832S possibly damaging Het
Igf1 G C 10: 87,864,860 V49L probably damaging Het
Lef1 A G 3: 131,115,500 D55G possibly damaging Het
Lipo2 G T 19: 33,721,007 Y323* probably null Het
Mettl24 C T 10: 40,737,798 R178C probably damaging Het
Nat6 A G 9: 107,583,026 E40G probably damaging Het
Ndrg4 C A 8: 95,706,601 C66* probably null Het
Nemf A G 12: 69,352,336 V140A probably benign Het
Olfr1076 A G 2: 86,508,792 E111G probably damaging Het
Olfr1459 A C 19: 13,145,742 S306A probably benign Het
Olfr876 A C 9: 37,804,845 *311C probably null Het
Olfr918 A T 9: 38,673,059 N141K possibly damaging Het
Pcdhga3 T C 18: 37,676,545 S684P probably benign Het
Plch1 A T 3: 63,753,141 C352* probably null Het
Plscr2 G A 9: 92,290,704 V139I probably benign Het
Ppa1 T A 10: 61,672,403 C270S probably benign Het
Ryr2 T A 13: 11,829,654 M399L possibly damaging Het
Scn3a A G 2: 65,525,754 V212A possibly damaging Het
Serpina3b A G 12: 104,133,026 K267E probably benign Het
Shroom3 A G 5: 92,942,204 T938A probably damaging Het
Specc1 A C 11: 62,132,453 S115R probably benign Het
Stim2 C T 5: 54,053,445 T74I probably benign Het
Sult6b2 T A 6: 142,804,299 D31V possibly damaging Het
Tbc1d24 A T 17: 24,182,518 W406R probably damaging Het
Tmprss11b A G 5: 86,663,386 probably null Het
Trappc9 A G 15: 72,925,650 Y575H possibly damaging Het
Trim63 C T 4: 134,323,101 T232M probably damaging Het
Ttn A T 2: 76,767,836 S19578T probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr63 T C 3: 146,080,429 E366G probably damaging Het
Xpo4 T A 14: 57,582,310 E1139D probably benign Het
Other mutations in Nid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Nid2 APN 14 19768677 missense probably benign
IGL01788:Nid2 APN 14 19807979 missense probably damaging 1.00
IGL02259:Nid2 APN 14 19768209 critical splice acceptor site probably null
IGL03084:Nid2 APN 14 19768932 missense probably benign 0.05
IGL03247:Nid2 APN 14 19779620 missense probably damaging 1.00
IGL03098:Nid2 UTSW 14 19805938 missense probably damaging 0.99
PIT4810001:Nid2 UTSW 14 19810090 missense possibly damaging 0.82
R0173:Nid2 UTSW 14 19802332 splice site probably benign
R0501:Nid2 UTSW 14 19789668 splice site probably null
R1117:Nid2 UTSW 14 19763664 critical splice acceptor site probably null
R1305:Nid2 UTSW 14 19768862 missense probably benign 0.00
R1572:Nid2 UTSW 14 19805412 missense probably benign 0.08
R1594:Nid2 UTSW 14 19781261 missense probably benign 0.03
R1789:Nid2 UTSW 14 19752431 missense possibly damaging 0.95
R1927:Nid2 UTSW 14 19768276 missense probably damaging 1.00
R2085:Nid2 UTSW 14 19778043 missense probably benign 0.12
R2086:Nid2 UTSW 14 19778043 missense probably benign 0.12
R2100:Nid2 UTSW 14 19778878 nonsense probably null
R2158:Nid2 UTSW 14 19778043 missense probably benign 0.12
R2240:Nid2 UTSW 14 19805914 missense probably damaging 0.99
R2314:Nid2 UTSW 14 19789761 missense probably benign 0.01
R2863:Nid2 UTSW 14 19768403 missense possibly damaging 0.92
R3113:Nid2 UTSW 14 19778043 missense probably benign 0.12
R3545:Nid2 UTSW 14 19763711 missense probably damaging 1.00
R3548:Nid2 UTSW 14 19763711 missense probably damaging 1.00
R3801:Nid2 UTSW 14 19809997 missense probably damaging 1.00
R4618:Nid2 UTSW 14 19808010 missense probably damaging 0.99
R4798:Nid2 UTSW 14 19789761 missense probably benign 0.01
R4953:Nid2 UTSW 14 19778078 nonsense probably null
R5256:Nid2 UTSW 14 19768208 critical splice acceptor site probably null
R5289:Nid2 UTSW 14 19805311 missense possibly damaging 0.95
R5302:Nid2 UTSW 14 19779701 missense probably benign
R5409:Nid2 UTSW 14 19805962 missense probably damaging 1.00
R5514:Nid2 UTSW 14 19802467 missense probably damaging 1.00
R6134:Nid2 UTSW 14 19778783 missense probably damaging 1.00
R6365:Nid2 UTSW 14 19803133 missense probably damaging 1.00
R6647:Nid2 UTSW 14 19802416 missense probably benign 0.04
R6758:Nid2 UTSW 14 19802483 missense probably damaging 1.00
R6882:Nid2 UTSW 14 19789707 missense probably damaging 1.00
R7045:Nid2 UTSW 14 19779681 missense possibly damaging 0.94
X0009:Nid2 UTSW 14 19802511 missense probably damaging 1.00
X0021:Nid2 UTSW 14 19768862 missense probably benign 0.00
X0026:Nid2 UTSW 14 19778131 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCAAAGACTCCGTCTCCTTC -3'
(R):5'- GGCAGAAAGACCCAAGTTGC -3'

Sequencing Primer
(F):5'- AAAGACTCCGTCTCCTTCCTTTC -3'
(R):5'- GACCCAAGTTGCAGTTCATCAG -3'
Posted On2018-11-06