Incidental Mutation 'R6893:Best1'
ID 538183
Institutional Source Beutler Lab
Gene Symbol Best1
Ensembl Gene ENSMUSG00000037418
Gene Name bestrophin 1
Synonyms best macular dystrophy, mBest1, Vmd2
MMRRC Submission 044987-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6893 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 9962538-9978997 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 9974446 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 33 (Y33H)
Ref Sequence ENSEMBL: ENSMUSP00000113053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117346] [ENSMUST00000121418]
AlphaFold O88870
Predicted Effect probably damaging
Transcript: ENSMUST00000117346
AA Change: Y33H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113053
Gene: ENSMUSG00000037418
AA Change: Y33H

DomainStartEndE-ValueType
Pfam:Bestrophin 8 316 8.5e-111 PFAM
low complexity region 476 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121418
SMART Domains Protein: ENSMUSP00000113828
Gene: ENSMUSG00000024663

DomainStartEndE-ValueType
Pfam:Sec2p 20 129 4.3e-30 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.7%
  • 20x: 95.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. Bestrophins may form chloride ion channels or may regulate voltage-gated L-type calcium-ion channels. Bestrophins are generally believed to form calcium-activated chloride-ion channels in epithelial cells but they have also been shown to be highly permeable to bicarbonate ion transport in retinal tissue. Mutations in this gene are responsible for juvenile-onset vitelliform macular dystrophy (VMD2), also known as Best macular dystrophy, in addition to adult-onset vitelliform macular dystrophy (AVMD) and other retinopathies. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous null mutations of this gene generally result in abnormal retinal pigment epithelium morphology and/or altered eye electrophysiology. Homozygotes for a null allele show male subfertility associated with abnormal sperm morphology and reduced motility in the absence of retinal pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T A 8: 25,368,770 (GRCm39) D538V probably damaging Het
Akap9 T C 5: 4,011,709 (GRCm39) I804T probably benign Het
Amy1 T C 3: 113,357,281 (GRCm39) E186G probably benign Het
Cacna1s C A 1: 136,005,431 (GRCm39) N405K probably benign Het
Casp7 T C 19: 56,421,741 (GRCm39) Y60H probably damaging Het
Ccdc61 T C 7: 18,626,488 (GRCm39) N367S possibly damaging Het
Cnksr3 A T 10: 7,085,129 (GRCm39) probably null Het
Col14a1 A C 15: 55,308,044 (GRCm39) probably benign Het
Cyp3a57 A T 5: 145,323,784 (GRCm39) K424* probably null Het
Dnai3 T C 3: 145,786,184 (GRCm39) E366G probably damaging Het
Dpep3 T C 8: 106,700,474 (GRCm39) K411E probably benign Het
Ebf2 T A 14: 67,475,008 (GRCm39) V81E probably benign Het
Ehbp1 G T 11: 21,964,945 (GRCm39) T1084K probably damaging Het
Fastkd2 C T 1: 63,770,953 (GRCm39) A103V possibly damaging Het
Gtf3c2 T C 5: 31,323,722 (GRCm39) K525E probably benign Het
Hdac2 A G 10: 36,873,003 (GRCm39) E287G probably damaging Het
Ifi207 T A 1: 173,555,208 (GRCm39) T832S possibly damaging Het
Igf1 G C 10: 87,700,722 (GRCm39) V49L probably damaging Het
Lef1 A G 3: 130,909,149 (GRCm39) D55G possibly damaging Het
Lipo2 G T 19: 33,698,407 (GRCm39) Y323* probably null Het
Mettl24 C T 10: 40,613,794 (GRCm39) R178C probably damaging Het
Naa80 A G 9: 107,460,225 (GRCm39) E40G probably damaging Het
Ndrg4 C A 8: 96,433,229 (GRCm39) C66* probably null Het
Nemf A G 12: 69,399,110 (GRCm39) V140A probably benign Het
Nid2 T A 14: 19,839,855 (GRCm39) F815I probably benign Het
Or4c108 A G 2: 88,804,143 (GRCm39) F31L probably benign Het
Or5b106 A C 19: 13,123,106 (GRCm39) S306A probably benign Het
Or8b12c A C 9: 37,716,141 (GRCm39) *311C probably null Het
Or8b3b A T 9: 38,584,355 (GRCm39) N141K possibly damaging Het
Or8k30 A G 2: 86,339,136 (GRCm39) E111G probably damaging Het
Pcdhga3 T C 18: 37,809,598 (GRCm39) S684P probably benign Het
Plch1 A T 3: 63,660,562 (GRCm39) C352* probably null Het
Plscr2 G A 9: 92,172,757 (GRCm39) V139I probably benign Het
Ppa1 T A 10: 61,508,182 (GRCm39) C270S probably benign Het
Ryr2 T A 13: 11,844,540 (GRCm39) M399L possibly damaging Het
Scn3a A G 2: 65,356,098 (GRCm39) V212A possibly damaging Het
Serpina3b A G 12: 104,099,285 (GRCm39) K267E probably benign Het
Shroom3 A G 5: 93,090,063 (GRCm39) T938A probably damaging Het
Specc1 A C 11: 62,023,279 (GRCm39) S115R probably benign Het
Stim2 C T 5: 54,210,787 (GRCm39) T74I probably benign Het
Sult6b2 T A 6: 142,750,025 (GRCm39) D31V possibly damaging Het
Tbc1d24 A T 17: 24,401,492 (GRCm39) W406R probably damaging Het
Tmprss11b A G 5: 86,811,245 (GRCm39) probably null Het
Trappc9 A G 15: 72,797,499 (GRCm39) Y575H possibly damaging Het
Trim63 C T 4: 134,050,412 (GRCm39) T232M probably damaging Het
Ttn A T 2: 76,598,180 (GRCm39) S19578T probably damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Xpo4 T A 14: 57,819,767 (GRCm39) E1139D probably benign Het
Other mutations in Best1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Best1 APN 19 9,964,099 (GRCm39) missense probably benign 0.22
IGL02129:Best1 APN 19 9,970,285 (GRCm39) missense probably benign
IGL02310:Best1 APN 19 9,966,516 (GRCm39) missense probably benign 0.00
IGL02470:Best1 APN 19 9,970,340 (GRCm39) missense probably benign 0.43
IGL02505:Best1 APN 19 9,966,514 (GRCm39) missense probably damaging 1.00
R0366:Best1 UTSW 19 9,969,417 (GRCm39) splice site probably null
R1476:Best1 UTSW 19 9,967,853 (GRCm39) nonsense probably null
R1674:Best1 UTSW 19 9,970,590 (GRCm39) critical splice donor site probably null
R2091:Best1 UTSW 19 9,969,443 (GRCm39) missense probably benign 0.27
R2516:Best1 UTSW 19 9,970,675 (GRCm39) nonsense probably null
R2866:Best1 UTSW 19 9,963,585 (GRCm39) missense probably benign
R4693:Best1 UTSW 19 9,974,499 (GRCm39) missense probably damaging 1.00
R4851:Best1 UTSW 19 9,969,062 (GRCm39) missense probably damaging 1.00
R4895:Best1 UTSW 19 9,970,135 (GRCm39) missense probably benign 0.00
R5633:Best1 UTSW 19 9,969,467 (GRCm39) missense probably benign 0.29
R5700:Best1 UTSW 19 9,974,563 (GRCm39) unclassified probably benign
R5837:Best1 UTSW 19 9,966,483 (GRCm39) splice site probably null
R7021:Best1 UTSW 19 9,964,143 (GRCm39) missense probably benign
R7220:Best1 UTSW 19 9,969,479 (GRCm39) missense probably benign 0.31
R7267:Best1 UTSW 19 9,964,177 (GRCm39) missense probably benign 0.00
R7284:Best1 UTSW 19 9,963,737 (GRCm39) critical splice acceptor site probably null
R7489:Best1 UTSW 19 9,974,410 (GRCm39) missense possibly damaging 0.68
R7568:Best1 UTSW 19 9,966,639 (GRCm39) critical splice acceptor site probably null
R7798:Best1 UTSW 19 9,969,035 (GRCm39) missense probably damaging 1.00
R8192:Best1 UTSW 19 9,963,664 (GRCm39) missense possibly damaging 0.52
R8523:Best1 UTSW 19 9,969,027 (GRCm39) missense possibly damaging 0.91
R9570:Best1 UTSW 19 9,970,331 (GRCm39) missense probably damaging 1.00
X0065:Best1 UTSW 19 9,964,339 (GRCm39) missense probably benign 0.03
Z1177:Best1 UTSW 19 9,970,603 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGGAACATCAGACCCTC -3'
(R):5'- TGCCTTCTGTGTCTCAGGCTAG -3'

Sequencing Primer
(F):5'- TGGAACATCAGACCCTCTCCTG -3'
(R):5'- AGATCAGAACCTAGTCTTTGACTCC -3'
Posted On 2018-11-06