Incidental Mutation 'R6894:Baz2a'
ID538236
Institutional Source Beutler Lab
Gene Symbol Baz2a
Ensembl Gene ENSMUSG00000040054
Gene Namebromodomain adjacent to zinc finger domain, 2A
SynonymsC030005G16Rik, Tip5, Walp3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6894 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location128091577-128129303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 128123581 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 1322 (A1322S)
Ref Sequence ENSEMBL: ENSMUSP00000151445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045621] [ENSMUST00000170054] [ENSMUST00000217851] [ENSMUST00000219072] [ENSMUST00000220049]
Predicted Effect probably benign
Transcript: ENSMUST00000045621
AA Change: A1319S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000044359
Gene: ENSMUSG00000040054
AA Change: A1319S

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 342 353 N/A INTRINSIC
low complexity region 421 475 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
MBD 539 614 3.87e-35 SMART
AT_hook 639 651 2.38e0 SMART
AT_hook 660 672 1.65e0 SMART
low complexity region 697 710 N/A INTRINSIC
coiled coil region 736 776 N/A INTRINSIC
DDT 837 902 3.75e-18 SMART
Pfam:WHIM1 939 988 4.8e-8 PFAM
low complexity region 1001 1013 N/A INTRINSIC
AT_hook 1174 1186 6.23e1 SMART
AT_hook 1388 1400 4.21e0 SMART
Pfam:WHIM3 1423 1464 1e-9 PFAM
PHD 1662 1708 1.47e-11 SMART
low complexity region 1741 1753 N/A INTRINSIC
BROMO 1773 1881 7.71e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170054
AA Change: A1320S

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129803
Gene: ENSMUSG00000040054
AA Change: A1320S

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
low complexity region 422 476 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
MBD 540 615 3.87e-35 SMART
AT_hook 640 652 2.38e0 SMART
AT_hook 661 673 1.65e0 SMART
low complexity region 698 711 N/A INTRINSIC
coiled coil region 737 777 N/A INTRINSIC
DDT 838 903 3.75e-18 SMART
Pfam:WHIM1 940 989 4.8e-8 PFAM
low complexity region 1002 1014 N/A INTRINSIC
AT_hook 1175 1187 6.23e1 SMART
AT_hook 1389 1401 4.21e0 SMART
Pfam:WHIM3 1424 1462 5.5e-19 PFAM
PHD 1663 1709 1.47e-11 SMART
low complexity region 1742 1754 N/A INTRINSIC
BROMO 1774 1882 7.71e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000217851
AA Change: A1322S

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000219072
Predicted Effect probably benign
Transcript: ENSMUST00000220049
AA Change: A1319S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik G A 6: 48,930,662 A199T probably damaging Het
2410089E03Rik T C 15: 8,187,368 L690P probably damaging Het
4921509C19Rik C A 2: 151,473,307 L150F probably damaging Het
4930449I24Rik G A 5: 146,504,732 E230K possibly damaging Het
4930449I24Rik A T 5: 146,504,733 E230V probably benign Het
9430038I01Rik A G 7: 137,387,388 C93R possibly damaging Het
Apobec1 T C 6: 122,591,242 probably benign Het
Arl4c T A 1: 88,701,375 D97V probably damaging Het
Ash1l A G 3: 88,982,991 T726A probably benign Het
Asz1 A C 6: 18,055,521 F359V probably damaging Het
Atr T A 9: 95,927,197 L1970H probably damaging Het
Cd209e T A 8: 3,853,569 I37F possibly damaging Het
Cd209f T C 8: 4,105,477 K37R probably benign Het
Cd5 G C 19: 10,738,839 S3C possibly damaging Het
Clec16a A T 16: 10,644,854 I260F probably damaging Het
Cltc A T 11: 86,712,602 Y799* probably null Het
Csde1 G A 3: 103,044,656 V258I possibly damaging Het
Dennd5a G T 7: 109,901,118 H909Q probably damaging Het
Dnah12 A G 14: 26,735,749 D890G probably damaging Het
Dnah2 A T 11: 69,484,260 M1379K probably benign Het
Dpp10 A T 1: 123,336,864 I743N probably damaging Het
Dpp9 T A 17: 56,188,321 T815S probably damaging Het
Ears2 T C 7: 122,048,224 N279S probably damaging Het
Ect2l A G 10: 18,169,380 probably null Het
Eomes C G 9: 118,481,285 P288A probably damaging Het
Fam205a1 G A 4: 42,850,291 P622S probably benign Het
Fat3 T C 9: 15,997,776 D2310G probably damaging Het
Fignl2 T C 15: 101,053,973 T143A probably benign Het
Gdf9 A G 11: 53,436,819 K201E possibly damaging Het
Gfra3 C T 18: 34,695,657 R228Q probably damaging Het
Grin1 A T 2: 25,295,817 V876E probably damaging Het
Igkv12-41 A C 6: 69,858,651 V39G probably damaging Het
Kat7 A T 11: 95,284,084 M367K possibly damaging Het
Ly6d T C 15: 74,762,805 K33E possibly damaging Het
Lztfl1 T C 9: 123,700,933 N273S possibly damaging Het
Macf1 T A 4: 123,483,687 I1485F possibly damaging Het
March10 G T 11: 105,396,961 L172I possibly damaging Het
Mdn1 T G 4: 32,748,614 S4220A possibly damaging Het
Muc16 A G 9: 18,495,576 V8460A possibly damaging Het
Myh14 A G 7: 44,633,512 F769L probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Mylk4 A G 13: 32,722,015 L395P probably damaging Het
Nat8f6 A T 6: 85,808,522 L215* probably null Het
Nell2 T C 15: 95,346,887 D443G probably damaging Het
Nkx6-3 A G 8: 23,157,616 K197R probably benign Het
Nt5c3 A T 6: 56,882,973 L293* probably null Het
Ntrk1 A T 3: 87,782,802 V429D probably damaging Het
Obscn A G 11: 59,132,682 V623A probably benign Het
Olfr1054 A T 2: 86,332,951 I135N probably damaging Het
Olfr1231 A G 2: 89,303,493 L33S probably damaging Het
Olfr1394 T C 11: 49,160,359 F115S probably benign Het
Olfr203 A G 16: 59,303,779 T209A probably damaging Het
Olfr467 C T 7: 107,815,064 T160I probably benign Het
Olfr821 T C 10: 130,034,309 S228P probably damaging Het
Pate3 T A 9: 35,646,673 D33V probably damaging Het
Pcnx T A 12: 81,987,973 I1843N probably damaging Het
Pla2g4f A T 2: 120,303,596 I503N probably benign Het
Prkg1 C A 19: 30,624,774 E361* probably null Het
Proca1 A G 11: 78,194,787 probably benign Het
Prss38 G T 11: 59,373,024 H287Q probably benign Het
Ptpdc1 T C 13: 48,590,638 E169G probably benign Het
Ptpn21 T C 12: 98,715,181 S65G probably damaging Het
Rfx6 A T 10: 51,716,039 H177L probably damaging Het
Slc20a2 G A 8: 22,560,593 G276D possibly damaging Het
Spag6l A T 16: 16,783,938 L159I probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Stk33 T A 7: 109,336,062 E174D possibly damaging Het
Stxbp5 A T 10: 9,784,361 V730E probably benign Het
Tmprss15 A T 16: 79,075,814 L168* probably null Het
Tnrc18 A T 5: 142,760,049 M1323K unknown Het
Tpr T C 1: 150,436,847 V1932A probably benign Het
Trak2 A G 1: 58,911,733 S432P probably damaging Het
Ttn A T 2: 76,908,190 F4002I probably benign Het
Txndc11 G A 16: 11,088,145 T507I probably damaging Het
Usp12 G A 5: 146,754,539 T135I possibly damaging Het
Vit T A 17: 78,626,758 Y596* probably null Het
Vmn1r32 A T 6: 66,553,361 Y144N possibly damaging Het
Vmn2r80 G T 10: 79,169,604 L358F probably benign Het
Zfp382 T G 7: 30,125,836 S38A probably benign Het
Other mutations in Baz2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Baz2a APN 10 128124935 missense probably benign 0.00
IGL00501:Baz2a APN 10 128114625 missense probably benign 0.14
IGL00743:Baz2a APN 10 128114526 missense probably benign
IGL01362:Baz2a APN 10 128121964 missense probably damaging 0.98
IGL01394:Baz2a APN 10 128118645 missense possibly damaging 0.46
IGL01603:Baz2a APN 10 128111168 missense probably damaging 0.98
IGL02165:Baz2a APN 10 128119349 missense probably benign 0.03
IGL02732:Baz2a APN 10 128125175 missense possibly damaging 0.66
IGL03030:Baz2a APN 10 128125146 missense possibly damaging 0.62
IGL03087:Baz2a APN 10 128122313 missense probably damaging 0.99
R0255:Baz2a UTSW 10 128114639 missense possibly damaging 0.66
R0737:Baz2a UTSW 10 128116080 missense possibly damaging 0.92
R0742:Baz2a UTSW 10 128113666 nonsense probably null
R0755:Baz2a UTSW 10 128119691 missense possibly damaging 0.92
R0798:Baz2a UTSW 10 128126323 splice site probably benign
R0879:Baz2a UTSW 10 128121304 missense probably damaging 0.99
R1023:Baz2a UTSW 10 128121807 missense possibly damaging 0.66
R1482:Baz2a UTSW 10 128109008 missense possibly damaging 0.92
R1512:Baz2a UTSW 10 128124152 missense possibly damaging 0.95
R1658:Baz2a UTSW 10 128124383 missense probably benign 0.04
R1983:Baz2a UTSW 10 128123959 missense probably benign 0.14
R2059:Baz2a UTSW 10 128113578 missense probably damaging 0.98
R2141:Baz2a UTSW 10 128123612 missense probably damaging 1.00
R2921:Baz2a UTSW 10 128125077 frame shift probably null
R2922:Baz2a UTSW 10 128125077 frame shift probably null
R3104:Baz2a UTSW 10 128125077 frame shift probably null
R3105:Baz2a UTSW 10 128125077 frame shift probably null
R3106:Baz2a UTSW 10 128125077 frame shift probably null
R3621:Baz2a UTSW 10 128125077 frame shift probably null
R3872:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R3873:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R3875:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R4600:Baz2a UTSW 10 128121183 missense probably damaging 0.97
R4692:Baz2a UTSW 10 128124893 missense probably damaging 1.00
R4717:Baz2a UTSW 10 128124942 missense possibly damaging 0.83
R4821:Baz2a UTSW 10 128111109 missense probably damaging 1.00
R4832:Baz2a UTSW 10 128123130 missense probably benign 0.08
R4893:Baz2a UTSW 10 128123415 missense possibly damaging 0.66
R4907:Baz2a UTSW 10 128110808 missense probably damaging 0.99
R5133:Baz2a UTSW 10 128116126 missense probably damaging 1.00
R5340:Baz2a UTSW 10 128115042 missense probably damaging 1.00
R5527:Baz2a UTSW 10 128124917 missense probably damaging 1.00
R5761:Baz2a UTSW 10 128119690 missense possibly damaging 0.66
R5891:Baz2a UTSW 10 128121322 missense probably damaging 1.00
R6088:Baz2a UTSW 10 128114642 small deletion probably benign
R6089:Baz2a UTSW 10 128114642 small deletion probably benign
R6323:Baz2a UTSW 10 128126417 missense probably benign 0.21
R7101:Baz2a UTSW 10 128121187 missense possibly damaging 0.66
R7178:Baz2a UTSW 10 128124457 missense probably damaging 0.98
R7179:Baz2a UTSW 10 128124457 missense probably damaging 0.98
R7202:Baz2a UTSW 10 128118559 missense possibly damaging 0.54
R7223:Baz2a UTSW 10 128112606 missense probably damaging 1.00
R7268:Baz2a UTSW 10 128124221 missense possibly damaging 0.66
R7426:Baz2a UTSW 10 128116078 missense probably damaging 1.00
R7464:Baz2a UTSW 10 128122073 missense possibly damaging 0.81
R7568:Baz2a UTSW 10 128125270 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGGGTTCCTAGAGCCAGAAG -3'
(R):5'- CAGCACCGGGTGTATTCATC -3'

Sequencing Primer
(F):5'- TTCCTAGAGCCAGAAGGTTCC -3'
(R):5'- GCACCGGGTGTATTCATCTACAAAG -3'
Posted On2018-11-06