Incidental Mutation 'R6895:Epb42'
ID538272
Institutional Source Beutler Lab
Gene Symbol Epb42
Ensembl Gene ENSMUSG00000023216
Gene Nameerythrocyte membrane protein band 4.2
SynonymsEpb4.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6895 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location121017891-121037072 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to A at 121036623 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023987] [ENSMUST00000102490]
Predicted Effect probably benign
Transcript: ENSMUST00000023987
SMART Domains Protein: ENSMUSP00000023987
Gene: ENSMUSG00000023216

DomainStartEndE-ValueType
Pfam:Transglut_N 5 126 8.9e-35 PFAM
TGc 260 353 3.52e-27 SMART
low complexity region 442 458 N/A INTRINSIC
Pfam:Transglut_C 475 552 5.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102490
SMART Domains Protein: ENSMUSP00000099548
Gene: ENSMUSG00000023216

DomainStartEndE-ValueType
Pfam:Transglut_N 6 124 5.8e-34 PFAM
TGc 260 353 3.52e-27 SMART
low complexity region 442 458 N/A INTRINSIC
Pfam:Transglut_C 475 580 8e-23 PFAM
Pfam:Transglut_C 588 686 8.8e-26 PFAM
Meta Mutation Damage Score 0.1928 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: The protein encoded by this gene is the key component of a macromolecular complex involved in the structure of erythrocytes. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit erythrocytic abnormalities including mild spherocytosis, altered ion transport, and dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Epb42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Epb42 APN 2 121027688 missense probably damaging 1.00
IGL01627:Epb42 APN 2 121025843 missense probably benign 0.06
IGL02059:Epb42 APN 2 121024707 missense probably damaging 0.96
IGL02869:Epb42 APN 2 121025746 missense probably benign
R0279:Epb42 UTSW 2 121029044 splice site probably benign
R0521:Epb42 UTSW 2 121029150 nonsense probably null
R1457:Epb42 UTSW 2 121029967 critical splice donor site probably null
R2157:Epb42 UTSW 2 121021762 missense probably benign
R2392:Epb42 UTSW 2 121029987 missense possibly damaging 0.85
R2407:Epb42 UTSW 2 121024752 missense probably damaging 1.00
R2866:Epb42 UTSW 2 121025921 missense possibly damaging 0.93
R2993:Epb42 UTSW 2 121029044 splice site probably benign
R3426:Epb42 UTSW 2 121030039 missense probably damaging 1.00
R3427:Epb42 UTSW 2 121030039 missense probably damaging 1.00
R4192:Epb42 UTSW 2 121030089 splice site probably null
R4940:Epb42 UTSW 2 121034451 missense probably damaging 1.00
R5368:Epb42 UTSW 2 121019462 missense probably benign 0.22
R5771:Epb42 UTSW 2 121021820 missense probably damaging 0.99
R6048:Epb42 UTSW 2 121024408 missense probably benign 0.00
R6362:Epb42 UTSW 2 121025779 missense possibly damaging 0.72
R6475:Epb42 UTSW 2 121027133 missense possibly damaging 0.53
R6711:Epb42 UTSW 2 121024108 intron probably benign
R6843:Epb42 UTSW 2 121027685 missense possibly damaging 0.85
R7154:Epb42 UTSW 2 121033362 missense probably benign 0.01
R7192:Epb42 UTSW 2 121024097 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGCCATGCAACTGCCTACC -3'
(R):5'- TTATTGATCTAGCCTGACAGACAG -3'

Sequencing Primer
(F):5'- TGCAACTGCCTACCCCACAC -3'
(R):5'- CAGCTGGCCTAGGAGATAGC -3'
Posted On2018-11-06