Incidental Mutation 'R6895:AU040320'
ID538277
Institutional Source Beutler Lab
Gene Symbol AU040320
Ensembl Gene ENSMUSG00000028830
Gene Nameexpressed sequence AU040320
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6895 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location126753544-126870070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126791930 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 100 (W100R)
Ref Sequence ENSEMBL: ENSMUSP00000099668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047431] [ENSMUST00000102607] [ENSMUST00000102608] [ENSMUST00000132660] [ENSMUST00000148935] [ENSMUST00000154640]
Predicted Effect probably damaging
Transcript: ENSMUST00000047431
AA Change: W100R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000037802
Gene: ENSMUSG00000028830
AA Change: W100R

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102607
AA Change: W100R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099667
Gene: ENSMUSG00000028830
AA Change: W100R

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102608
AA Change: W100R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099668
Gene: ENSMUSG00000028830
AA Change: W100R

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132660
Predicted Effect probably benign
Transcript: ENSMUST00000148935
Predicted Effect probably damaging
Transcript: ENSMUST00000154640
AA Change: W100R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122352
Gene: ENSMUSG00000028830
AA Change: W100R

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
Meta Mutation Damage Score 0.354 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate gene for dyslexia susceptibility.[provided by RefSeq, Apr 2009]
PHENOTYPE: Null mice display decreased susceptibility to adenoviral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in AU040320
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:AU040320 APN 4 126792234 missense probably benign
IGL00835:AU040320 APN 4 126757071 splice site probably null
IGL00964:AU040320 APN 4 126854406 nonsense probably null
IGL00978:AU040320 APN 4 126828839 missense probably benign 0.00
IGL01396:AU040320 APN 4 126869378 intron probably benign
IGL02129:AU040320 APN 4 126823692 missense probably damaging 1.00
IGL02148:AU040320 APN 4 126839676 missense possibly damaging 0.64
IGL02179:AU040320 APN 4 126835612 missense probably benign 0.43
IGL02696:AU040320 APN 4 126842587 missense probably damaging 1.00
PIT4677001:AU040320 UTSW 4 126792237 missense probably benign 0.00
R0063:AU040320 UTSW 4 126839672 missense probably damaging 1.00
R0063:AU040320 UTSW 4 126839672 missense probably damaging 1.00
R0356:AU040320 UTSW 4 126837362 missense probably damaging 1.00
R0865:AU040320 UTSW 4 126848884 missense possibly damaging 0.94
R1165:AU040320 UTSW 4 126823640 splice site probably benign
R1216:AU040320 UTSW 4 126816483 splice site probably benign
R1464:AU040320 UTSW 4 126792031 missense possibly damaging 0.92
R1464:AU040320 UTSW 4 126792031 missense possibly damaging 0.92
R1751:AU040320 UTSW 4 126840724 missense probably damaging 1.00
R1767:AU040320 UTSW 4 126840724 missense probably damaging 1.00
R1900:AU040320 UTSW 4 126853280 splice site probably null
R2173:AU040320 UTSW 4 126792276 missense probably benign 0.02
R2414:AU040320 UTSW 4 126868691 critical splice acceptor site probably null
R4061:AU040320 UTSW 4 126835695 missense probably damaging 1.00
R4354:AU040320 UTSW 4 126854399 unclassified probably benign
R4751:AU040320 UTSW 4 126854466 splice site probably null
R4790:AU040320 UTSW 4 126847215 missense possibly damaging 0.62
R4799:AU040320 UTSW 4 126839669 missense probably benign 0.01
R4825:AU040320 UTSW 4 126791793 missense probably damaging 1.00
R4908:AU040320 UTSW 4 126853288 missense probably damaging 1.00
R4914:AU040320 UTSW 4 126835676 nonsense probably null
R5085:AU040320 UTSW 4 126828871 missense possibly damaging 0.83
R5320:AU040320 UTSW 4 126823716 missense possibly damaging 0.52
R5410:AU040320 UTSW 4 126823716 missense possibly damaging 0.52
R5543:AU040320 UTSW 4 126841224 missense probably damaging 1.00
R5684:AU040320 UTSW 4 126792146 missense probably benign 0.06
R5729:AU040320 UTSW 4 126830415 missense probably damaging 1.00
R5918:AU040320 UTSW 4 126814271 missense probably benign 0.32
R6123:AU040320 UTSW 4 126869386 intron probably benign
R6456:AU040320 UTSW 4 126842491 missense probably benign 0.03
R6523:AU040320 UTSW 4 126868760 critical splice donor site probably null
R6591:AU040320 UTSW 4 126836670 missense possibly damaging 0.81
R6603:AU040320 UTSW 4 126792253 missense probably benign 0.02
R6664:AU040320 UTSW 4 126835650 missense probably damaging 1.00
R6691:AU040320 UTSW 4 126836670 missense possibly damaging 0.81
R6864:AU040320 UTSW 4 126847819 missense probably damaging 0.98
R6891:AU040320 UTSW 4 126846438 missense possibly damaging 0.93
R7064:AU040320 UTSW 4 126792072 missense probably benign 0.01
R7351:AU040320 UTSW 4 126816444 missense probably damaging 0.98
R7453:AU040320 UTSW 4 126835700 critical splice donor site probably null
R7467:AU040320 UTSW 4 126814310 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATTCTGCCTCAGATGCTGG -3'
(R):5'- CCTAGCCTCAGAAGATGTGG -3'

Sequencing Primer
(F):5'- GACTCACAGTAATCTCGTGCTGG -3'
(R):5'- TGGTTCATCATCTTCAGGCAG -3'
Posted On2018-11-06