Incidental Mutation 'R6895:Ugt2b36'
ID538279
Institutional Source Beutler Lab
Gene Symbol Ugt2b36
Ensembl Gene ENSMUSG00000070704
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B36
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6895 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location87065927-87092555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87092298 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 76 (T76I)
Ref Sequence ENSEMBL: ENSMUSP00000092233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094649] [ENSMUST00000132667] [ENSMUST00000145617]
Predicted Effect probably benign
Transcript: ENSMUST00000094649
AA Change: T76I

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000092233
Gene: ENSMUSG00000070704
AA Change: T76I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 6.9e-260 PFAM
Pfam:Glyco_tran_28_C 339 448 2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132667
AA Change: T76I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000123024
Gene: ENSMUSG00000070704
AA Change: T76I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 105 1.1e-23 PFAM
Pfam:UDPGT 99 265 7.4e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145617
SMART Domains Protein: ENSMUSP00000120005
Gene: ENSMUSG00000070704

DomainStartEndE-ValueType
Pfam:UDPGT 22 249 2.1e-127 PFAM
Pfam:Glyco_tran_28_C 164 245 1.7e-9 PFAM
Meta Mutation Damage Score 0.1324 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Ugt2b36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Ugt2b36 APN 5 87081581 missense possibly damaging 0.73
IGL01024:Ugt2b36 APN 5 87080869 critical splice donor site probably null
IGL01295:Ugt2b36 APN 5 87080885 missense probably damaging 1.00
IGL01331:Ugt2b36 APN 5 87090942 missense probably damaging 1.00
IGL02597:Ugt2b36 APN 5 87080924 missense probably damaging 1.00
IGL02967:Ugt2b36 APN 5 87090900 missense possibly damaging 0.48
IGL03053:Ugt2b36 APN 5 87092074 missense possibly damaging 0.95
R0370:Ugt2b36 UTSW 5 87091975 missense probably benign 0.04
R0616:Ugt2b36 UTSW 5 87089477 missense probably benign 0.01
R0827:Ugt2b36 UTSW 5 87066375 missense possibly damaging 0.83
R0885:Ugt2b36 UTSW 5 87091989 missense probably benign 0.03
R1471:Ugt2b36 UTSW 5 87092071 missense probably damaging 1.00
R1567:Ugt2b36 UTSW 5 87092399 missense probably damaging 1.00
R1782:Ugt2b36 UTSW 5 87081581 missense possibly damaging 0.73
R1974:Ugt2b36 UTSW 5 87080868 critical splice donor site probably null
R2065:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2066:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2068:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2111:Ugt2b36 UTSW 5 87092241 missense probably benign 0.03
R2272:Ugt2b36 UTSW 5 87066255 missense possibly damaging 0.65
R2696:Ugt2b36 UTSW 5 87089485 missense probably damaging 1.00
R4626:Ugt2b36 UTSW 5 87092088 missense probably damaging 1.00
R4700:Ugt2b36 UTSW 5 87092442 critical splice donor site probably null
R4731:Ugt2b36 UTSW 5 87081538 nonsense probably null
R4732:Ugt2b36 UTSW 5 87081538 nonsense probably null
R4733:Ugt2b36 UTSW 5 87081538 nonsense probably null
R4922:Ugt2b36 UTSW 5 87066324 missense probably damaging 1.00
R5217:Ugt2b36 UTSW 5 87066255 missense probably damaging 0.97
R5244:Ugt2b36 UTSW 5 87091906 missense probably damaging 0.99
R5341:Ugt2b36 UTSW 5 87092228 nonsense probably null
R5478:Ugt2b36 UTSW 5 87089482 missense probably damaging 1.00
R5572:Ugt2b36 UTSW 5 87089482 missense possibly damaging 0.89
R5722:Ugt2b36 UTSW 5 87092438 nonsense probably null
R5961:Ugt2b36 UTSW 5 87080865 splice site probably null
R6034:Ugt2b36 UTSW 5 87081518 missense probably damaging 1.00
R6034:Ugt2b36 UTSW 5 87081518 missense probably damaging 1.00
R6139:Ugt2b36 UTSW 5 87092171 missense probably benign
R6145:Ugt2b36 UTSW 5 87066213 missense probably benign
R6226:Ugt2b36 UTSW 5 87092130 missense probably damaging 0.99
R6531:Ugt2b36 UTSW 5 87081586 missense probably damaging 1.00
R6704:Ugt2b36 UTSW 5 87092131 missense probably damaging 1.00
R7218:Ugt2b36 UTSW 5 87081539 missense probably damaging 1.00
R7258:Ugt2b36 UTSW 5 87080903 missense probably damaging 1.00
R7310:Ugt2b36 UTSW 5 87066279 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGACATCAAACTTGGATTCCTGG -3'
(R):5'- TGCTGCTTCAGATCTGCAAAG -3'

Sequencing Primer
(F):5'- CCTGGAGTTTTGCCATGAGC -3'
(R):5'- CTTCAGATCTGCAAAGTGTGG -3'
Posted On2018-11-06