Incidental Mutation 'R6895:Gpt2'
ID538287
Institutional Source Beutler Lab
Gene Symbol Gpt2
Ensembl Gene ENSMUSG00000031700
Gene Nameglutamic pyruvate transaminase (alanine aminotransferase) 2
SynonymsALT2, 4631422C05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R6895 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location85492576-85527560 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85518052 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 325 (E325K)
Ref Sequence ENSEMBL: ENSMUSP00000034136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034136] [ENSMUST00000132932]
Predicted Effect probably benign
Transcript: ENSMUST00000034136
AA Change: E325K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034136
Gene: ENSMUSG00000031700
AA Change: E325K

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
Pfam:Aminotran_1_2 110 510 6.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132932
SMART Domains Protein: ENSMUSP00000115968
Gene: ENSMUSG00000031700

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
PDB:3IHJ|A 48 148 6e-63 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143846
Meta Mutation Damage Score 0.058 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial alanine transaminase, a pyridoxal enzyme that catalyzes the reversible transamination between alanine and 2-oxoglutarate to generate pyruvate and glutamate. Alanine transaminases play roles in gluconeogenesis and amino acid metabolism in many tissues including skeletal muscle, kidney, and liver. Activating transcription factor 4 upregulates this gene under metabolic stress conditions in hepatocyte cell lines. A loss of function mutation in this gene has been associated with developmental encephalopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity, reduced postnatal brain growth, various metabolic defects in pathways involving amino acid metabolism, the TCA cycle and neuroprotective mechanisms, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Gpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Gpt2 APN 8 85512324 missense probably benign
IGL01611:Gpt2 APN 8 85519538 nonsense probably null
IGL02385:Gpt2 APN 8 85516153 splice site probably null
IGL02484:Gpt2 APN 8 85516233 missense probably damaging 1.00
IGL02589:Gpt2 APN 8 85516166 nonsense probably null
IGL02669:Gpt2 APN 8 85523279 missense probably benign 0.02
R1191:Gpt2 UTSW 8 85509272 missense probably damaging 1.00
R1599:Gpt2 UTSW 8 85512234 missense probably damaging 1.00
R1944:Gpt2 UTSW 8 85517996 missense probably damaging 1.00
R1953:Gpt2 UTSW 8 85521384 missense probably benign 0.00
R1962:Gpt2 UTSW 8 85493135 missense probably damaging 0.99
R1982:Gpt2 UTSW 8 85516203 missense possibly damaging 0.75
R2283:Gpt2 UTSW 8 85516189 missense probably benign
R3785:Gpt2 UTSW 8 85525573 missense probably benign
R3786:Gpt2 UTSW 8 85525573 missense probably benign
R3787:Gpt2 UTSW 8 85525573 missense probably benign
R4402:Gpt2 UTSW 8 85525559 missense probably benign 0.32
R4974:Gpt2 UTSW 8 85519439 splice site probably benign
R5457:Gpt2 UTSW 8 85512338 missense possibly damaging 0.90
R5589:Gpt2 UTSW 8 85493111 missense probably damaging 1.00
R5734:Gpt2 UTSW 8 85523256 missense probably benign 0.17
R5924:Gpt2 UTSW 8 85493004 missense probably damaging 1.00
R6371:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6651:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6652:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6898:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6923:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6955:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R6956:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7112:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7113:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7115:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7124:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7125:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7327:Gpt2 UTSW 8 85518052 missense probably benign 0.03
R7486:Gpt2 UTSW 8 85525606 missense probably damaging 0.98
X0058:Gpt2 UTSW 8 85518019 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGGCCTTCACCTGACAACAG -3'
(R):5'- TTCTTACACCAGCGGCAAGTG -3'

Sequencing Primer
(F):5'- ACAGGTTAACTCCGTACCTATG -3'
(R):5'- CAAGTGATGAAGGCTGCTTTCTAACC -3'
Posted On2018-11-06