Incidental Mutation 'R6895:Olfr916'
ID538290
Institutional Source Beutler Lab
Gene Symbol Olfr916
Ensembl Gene ENSMUSG00000094701
Gene Nameolfactory receptor 916
SynonymsGA_x6K02T2PVTD-32360710-32359778, MOR168-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6895 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38655052-38659875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 38658089 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 101 (L101R)
Ref Sequence ENSEMBL: ENSMUSP00000149578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081196] [ENSMUST00000213714] [ENSMUST00000214093] [ENSMUST00000215291]
Predicted Effect probably damaging
Transcript: ENSMUST00000081196
AA Change: L101R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079959
Gene: ENSMUSG00000094701
AA Change: L101R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-45 PFAM
Pfam:7tm_1 41 290 1.3e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213714
AA Change: L101R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000214093
AA Change: L101R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000215291
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Olfr916
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01965:Olfr916 APN 9 38657622 missense probably benign 0.00
IGL02313:Olfr916 APN 9 38658066 missense probably damaging 0.97
IGL03221:Olfr916 APN 9 38658365 missense probably damaging 0.99
R0479:Olfr916 UTSW 9 38658182 missense probably damaging 1.00
R1507:Olfr916 UTSW 9 38658014 missense probably damaging 1.00
R1521:Olfr916 UTSW 9 38657718 missense probably damaging 0.99
R1860:Olfr916 UTSW 9 38658365 missense probably damaging 0.99
R3107:Olfr916 UTSW 9 38658011 missense possibly damaging 0.48
R3964:Olfr916 UTSW 9 38657727 missense probably benign 0.42
R3965:Olfr916 UTSW 9 38657727 missense probably benign 0.42
R4419:Olfr916 UTSW 9 38658069 missense probably benign 0.01
R5249:Olfr916 UTSW 9 38658078 missense possibly damaging 0.88
R5481:Olfr916 UTSW 9 38657620 missense probably benign 0.00
R6299:Olfr916 UTSW 9 38657777 missense possibly damaging 0.94
R6555:Olfr916 UTSW 9 38658289 missense probably benign 0.00
R6702:Olfr916 UTSW 9 38657777 missense possibly damaging 0.94
R6703:Olfr916 UTSW 9 38657777 missense possibly damaging 0.94
R6851:Olfr916 UTSW 9 38658185 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TCATTATGCAAACAGTGTGAGCC -3'
(R):5'- CTGGCAATGTACCTAGTCACTG -3'

Sequencing Primer
(F):5'- GTGTGAGCCACAGACTCAG -3'
(R):5'- CAATGTACCTAGTCACTGCATTGGG -3'
Posted On2018-11-06