Incidental Mutation 'R6895:Lrrc72'
ID538297
Institutional Source Beutler Lab
Gene Symbol Lrrc72
Ensembl Gene ENSMUSG00000020545
Gene Nameleucine rich repeat containing 72
Synonyms1700108M19Rik, 4933421E18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6895 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location36208345-36253398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 36209718 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 43 (D43A)
Ref Sequence ENSEMBL: ENSMUSP00000020853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020853] [ENSMUST00000122115] [ENSMUST00000221155]
Predicted Effect probably damaging
Transcript: ENSMUST00000020853
AA Change: D43A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000122115
AA Change: D95A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113517
Gene: ENSMUSG00000020545
AA Change: D95A

DomainStartEndE-ValueType
Pfam:LRR_9 1 69 6.6e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000221155
AA Change: D225A

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Lrrc72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Lrrc72 APN 12 36221508 missense probably benign 0.01
IGL01573:Lrrc72 APN 12 36212562 splice site probably null
R1905:Lrrc72 UTSW 12 36208662 unclassified probably null
R3754:Lrrc72 UTSW 12 36212568 missense probably benign 0.04
R4429:Lrrc72 UTSW 12 36208624 missense probably damaging 1.00
R6263:Lrrc72 UTSW 12 36208604 nonsense probably null
R7263:Lrrc72 UTSW 12 36208612 missense probably damaging 1.00
R7410:Lrrc72 UTSW 12 36222804 missense probably damaging 1.00
R7452:Lrrc72 UTSW 12 36212693 missense probably benign 0.11
V8831:Lrrc72 UTSW 12 36208657 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGAACACATAGCTGGAACTCATTTG -3'
(R):5'- TTTGCCGCATATTAAACACTACCC -3'

Sequencing Primer
(F):5'- AGCTGGAACTCATTTGTCAAAG -3'
(R):5'- CCAAAGTCTAAAGCAAAATGCCTTAC -3'
Posted On2018-11-06