Incidental Mutation 'R6895:Fam120a'
ID538301
Institutional Source Beutler Lab
Gene Symbol Fam120a
Ensembl Gene ENSMUSG00000038014
Gene Namefamily with sequence similarity 120, member A
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6895 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location48879219-48968017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48892021 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 780 (F780L)
Ref Sequence ENSEMBL: ENSMUSP00000053877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060805]
Predicted Effect probably benign
Transcript: ENSMUST00000060805
AA Change: F780L

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000053877
Gene: ENSMUSG00000038014
AA Change: F780L

DomainStartEndE-ValueType
Blast:XPGN 1 112 1e-15 BLAST
low complexity region 348 361 N/A INTRINSIC
low complexity region 453 468 N/A INTRINSIC
low complexity region 852 866 N/A INTRINSIC
low complexity region 881 897 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
low complexity region 972 986 N/A INTRINSIC
low complexity region 996 1006 N/A INTRINSIC
low complexity region 1026 1044 N/A INTRINSIC
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Larp4 T G 15: 100,007,730 probably null Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Fam120a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Fam120a APN 13 48889133 missense probably benign
IGL01087:Fam120a APN 13 48902073 missense probably damaging 1.00
IGL02052:Fam120a APN 13 48933945 splice site probably benign
IGL02409:Fam120a APN 13 48967359 missense probably benign 0.05
IGL03172:Fam120a APN 13 48910336 missense probably damaging 1.00
Green_flash UTSW 13 48891964 missense probably damaging 1.00
Sunset UTSW 13 48910250 splice site probably null
upended UTSW 13 48897667 missense probably damaging 1.00
R0036:Fam120a UTSW 13 48889264 splice site probably benign
R0042:Fam120a UTSW 13 48934014 missense probably damaging 1.00
R0689:Fam120a UTSW 13 48967638 missense probably damaging 1.00
R0741:Fam120a UTSW 13 48891940 missense possibly damaging 0.91
R0899:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0900:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0987:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0989:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R0990:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1080:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1121:Fam120a UTSW 13 48910437 splice site probably null
R1265:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1423:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1611:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1755:Fam120a UTSW 13 48885743 missense possibly damaging 0.70
R1888:Fam120a UTSW 13 48885866 missense possibly damaging 0.50
R1888:Fam120a UTSW 13 48885866 missense possibly damaging 0.50
R2041:Fam120a UTSW 13 48897767 missense probably benign 0.01
R2433:Fam120a UTSW 13 48933968 missense probably damaging 1.00
R2496:Fam120a UTSW 13 48967593 missense probably damaging 0.99
R3122:Fam120a UTSW 13 48892086 missense possibly damaging 0.45
R4279:Fam120a UTSW 13 48889258 missense probably benign 0.00
R4758:Fam120a UTSW 13 48880857 missense probably benign 0.02
R4924:Fam120a UTSW 13 48902096 missense probably benign 0.04
R5000:Fam120a UTSW 13 48897667 missense probably damaging 1.00
R5039:Fam120a UTSW 13 48910250 splice site probably null
R5194:Fam120a UTSW 13 48880935 missense probably benign
R5772:Fam120a UTSW 13 48880933 missense probably benign
R6765:Fam120a UTSW 13 48891964 missense probably damaging 1.00
R6820:Fam120a UTSW 13 48880992 missense possibly damaging 0.51
R6833:Fam120a UTSW 13 48934041 missense probably damaging 1.00
R6946:Fam120a UTSW 13 48881020 missense possibly damaging 0.83
R7032:Fam120a UTSW 13 48949113 missense probably benign 0.34
R7081:Fam120a UTSW 13 48910325 missense probably damaging 0.98
R7289:Fam120a UTSW 13 48892006 missense probably damaging 1.00
R7503:Fam120a UTSW 13 48949247 missense not run
X0003:Fam120a UTSW 13 48949138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGTCAGAGATGGCTGCC -3'
(R):5'- TCTGGCTTTCTTTGAGTAAGACC -3'

Sequencing Primer
(F):5'- TCAGAGATGGCTGCCCTGTC -3'
(R):5'- TGAAGCCAAGGTGTGCTC -3'
Posted On2018-11-06