Incidental Mutation 'R6895:Larp4'
ID538305
Institutional Source Beutler Lab
Gene Symbol Larp4
Ensembl Gene ENSMUSG00000023025
Gene NameLa ribonucleoprotein domain family, member 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R6895 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99970065-100016358 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 100007730 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057632] [ENSMUST00000100206] [ENSMUST00000230521] [ENSMUST00000230956] [ENSMUST00000231160]
Predicted Effect probably null
Transcript: ENSMUST00000057632
SMART Domains Protein: ENSMUSP00000086964
Gene: ENSMUSG00000023025

DomainStartEndE-ValueType
LA 112 190 2.44e-40 SMART
RRM 195 265 3.28e-2 SMART
low complexity region 375 388 N/A INTRINSIC
low complexity region 433 453 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100206
SMART Domains Protein: ENSMUSP00000097780
Gene: ENSMUSG00000023025

DomainStartEndE-ValueType
LA 113 191 2.44e-40 SMART
RRM 196 266 3.28e-2 SMART
low complexity region 376 389 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 458 471 N/A INTRINSIC
low complexity region 652 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230521
Predicted Effect probably null
Transcript: ENSMUST00000230956
Predicted Effect probably null
Transcript: ENSMUST00000231160
Meta Mutation Damage Score 0.598 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 A G 18: 12,260,989 V256A probably benign Het
Arid4a A G 12: 71,063,302 D139G probably benign Het
AU040320 T C 4: 126,791,930 W100R probably damaging Het
C4bp T C 1: 130,636,206 *470W probably null Het
Capn8 C A 1: 182,628,669 D661E possibly damaging Het
Car14 T C 3: 95,898,160 T334A probably benign Het
Chd6 T A 2: 160,988,340 T1012S probably damaging Het
Csmd3 T C 15: 47,666,514 probably null Het
Dnaaf2 A G 12: 69,197,663 V208A probably benign Het
Dnah11 A G 12: 117,995,191 W2986R probably damaging Het
Epb42 G A 2: 121,036,623 probably benign Het
Fam120a A G 13: 48,892,021 F780L probably benign Het
Gm4788 G A 1: 139,740,472 P308S possibly damaging Het
Gpt2 G A 8: 85,518,052 E325K probably benign Het
Grid2 T C 6: 64,395,299 F655S probably damaging Het
Homer3 T C 8: 70,285,305 S2P probably damaging Het
Hydin T C 8: 110,312,251 V207A probably benign Het
Inpp5j T C 11: 3,495,557 probably null Het
Jak1 C T 4: 101,154,537 probably null Het
Jmjd1c A G 10: 67,217,090 I220V probably benign Het
Kat6a T G 8: 22,935,783 S1115A possibly damaging Het
Lrrc72 T G 12: 36,209,718 D43A probably damaging Het
Mptx2 A C 1: 173,277,685 V13G probably benign Het
Nmbr A T 10: 14,769,960 *258Y probably null Het
Nup210l C T 3: 90,159,924 A757V probably damaging Het
Nup62 A G 7: 44,829,733 K391E possibly damaging Het
Nup93 T A 8: 94,243,686 I71K probably damaging Het
Olfr294 A T 7: 86,616,115 C177S probably damaging Het
Olfr916 A C 9: 38,658,089 L101R probably damaging Het
Pik3cg A G 12: 32,204,347 M547T possibly damaging Het
Ropn1 A T 16: 34,677,298 I187F possibly damaging Het
Rtp3 T C 9: 110,987,196 R96G possibly damaging Het
Sfrp5 A T 19: 42,199,788 S197R probably damaging Het
Slc12a6 A G 2: 112,355,095 H903R probably damaging Het
Slc26a3 G T 12: 31,463,524 A482S probably damaging Het
Slc2a12 G T 10: 22,692,185 A504S probably damaging Het
Slitrk5 C A 14: 111,681,653 P903Q probably damaging Het
Tas2r123 A T 6: 132,847,170 H10L probably benign Het
Tex46 T C 4: 136,612,901 V99A probably benign Het
Top2b T C 14: 16,413,604 V1024A probably benign Het
Ugt2b36 G A 5: 87,092,298 T76I probably benign Het
Usp31 G T 7: 121,653,176 T747K probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Larp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Larp4 APN 15 99987421 missense probably damaging 0.98
IGL01668:Larp4 APN 15 99987474 missense probably damaging 1.00
IGL01687:Larp4 APN 15 99996488 missense probably damaging 1.00
IGL02105:Larp4 APN 15 99986071 missense probably damaging 1.00
IGL02676:Larp4 APN 15 99990421 missense possibly damaging 0.94
IGL03286:Larp4 APN 15 99986086 missense probably damaging 1.00
R1076:Larp4 UTSW 15 99997430 missense probably benign 0.00
R1996:Larp4 UTSW 15 99984963 missense probably damaging 1.00
R2183:Larp4 UTSW 15 100011897 missense probably benign 0.16
R2260:Larp4 UTSW 15 99997396 missense possibly damaging 0.95
R3777:Larp4 UTSW 15 99990357 missense probably damaging 1.00
R3916:Larp4 UTSW 15 99990403 missense probably benign 0.00
R3962:Larp4 UTSW 15 100012145 missense probably damaging 1.00
R5059:Larp4 UTSW 15 100005290 missense probably damaging 1.00
R5081:Larp4 UTSW 15 99973017 intron probably benign
R5104:Larp4 UTSW 15 99986083 missense probably damaging 1.00
R5409:Larp4 UTSW 15 99986064 missense probably damaging 0.98
R5436:Larp4 UTSW 15 99986114 missense probably damaging 0.98
R7316:Larp4 UTSW 15 100001017 missense probably benign
R7483:Larp4 UTSW 15 99991778 missense probably benign 0.01
R7510:Larp4 UTSW 15 99993377 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGTGGTCACTGAGATACTTTAGTAC -3'
(R):5'- AAACTGGCTTGATCCCCAC -3'

Sequencing Primer
(F):5'- ACTTAGTGTACGCTTATTAAAGTGAC -3'
(R):5'- TTCAGTGATGCAGTACCAGC -3'
Posted On2018-11-06