Incidental Mutation 'R6896:Abcg2'
ID538327
Institutional Source Beutler Lab
Gene Symbol Abcg2
Ensembl Gene ENSMUSG00000029802
Gene NameATP binding cassette subfamily G member 2 (Junior blood group)
SynonymsBcrp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6896 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location58584523-58695676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58683313 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 454 (L454P)
Ref Sequence ENSEMBL: ENSMUSP00000138608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031822] [ENSMUST00000114294] [ENSMUST00000143752] [ENSMUST00000203146]
Predicted Effect probably damaging
Transcript: ENSMUST00000031822
AA Change: L454P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031822
Gene: ENSMUSG00000029802
AA Change: L454P

DomainStartEndE-ValueType
AAA 71 269 9.08e-6 SMART
Pfam:ABC2_membrane 375 586 5.4e-42 PFAM
transmembrane domain 631 653 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114294
AA Change: L454P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109933
Gene: ENSMUSG00000029802
AA Change: L454P

DomainStartEndE-ValueType
AAA 71 269 9.08e-6 SMART
Pfam:ABC2_membrane 375 586 1.2e-40 PFAM
transmembrane domain 631 653 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143752
AA Change: L454P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138608
Gene: ENSMUSG00000029802
AA Change: L454P

DomainStartEndE-ValueType
AAA 71 269 9.08e-6 SMART
Pfam:ABC2_membrane 375 573 7.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145685
Predicted Effect probably benign
Transcript: ENSMUST00000203146
SMART Domains Protein: ENSMUSP00000145435
Gene: ENSMUSG00000029802

DomainStartEndE-ValueType
SCOP:d1jj7a_ 33 129 7e-8 SMART
Blast:AAA 71 125 3e-32 BLAST
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is included in the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. Alternatively referred to as a breast cancer resistance protein, the human protein functions as a xenobiotic transporter which may play a major role in multi-drug resistance. This protein likely serves as a cellular defense mechanism in response to mitoxantrone and anthracycline exposure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit extreme sensitivity to the dietary chlorophyll-catabolite pheophorbide a, resulting in severe phototoxic skin lesions upon light exposure. Mutants show a novel form of protoporphyria, associated with a 10-fold increase in erythrocyte levels of protoporphyrin IX. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadm T C 3: 153,936,320 I192V probably damaging Het
Acadsb T A 7: 131,443,646 Y436N probably benign Het
Ache G A 5: 137,291,734 V442M probably damaging Het
Adam39 A T 8: 40,824,938 N122I possibly damaging Het
Akap6 A T 12: 52,887,494 I590F probably benign Het
Akap8 T C 17: 32,317,331 N36S probably benign Het
Asap2 T C 12: 21,265,525 S933P probably damaging Het
C3 C T 17: 57,220,864 probably null Het
Cdon T A 9: 35,452,106 M1K probably null Het
Cemip T A 7: 83,998,576 I99F probably damaging Het
Cfap58 T G 19: 47,944,187 L130R probably damaging Het
Clca3a2 T C 3: 144,808,701 D415G probably damaging Het
Coch A G 12: 51,602,869 D321G possibly damaging Het
Efcab11 A G 12: 99,883,415 probably benign Het
Ermap G T 4: 119,187,131 S156* probably null Het
Fap G T 2: 62,504,600 Y620* probably null Het
Galntl5 T C 5: 25,189,949 probably null Het
Il21r C A 7: 125,626,956 H76N probably damaging Het
Itpr1 T G 6: 108,481,394 Y2041D probably damaging Het
Megf8 T A 7: 25,329,932 N300K probably benign Het
Muc2 G A 7: 141,752,695 V285I possibly damaging Het
Myh15 A T 16: 49,113,071 Q623L probably benign Het
Myh7b T C 2: 155,622,568 probably null Het
Naaladl1 T A 19: 6,109,305 probably null Het
Nlrp9b T G 7: 20,023,245 F136V probably damaging Het
Olfr1006 A G 2: 85,674,933 Y73H probably damaging Het
Olfr1193 A G 2: 88,677,996 N47S probably damaging Het
Olfr516 T C 7: 108,845,543 T156A probably benign Het
Olfr814 A T 10: 129,874,754 M1K probably null Het
Oprd1 A T 4: 132,117,301 M132K probably damaging Het
Patj T A 4: 98,426,050 V369D possibly damaging Het
Pcdhb3 T C 18: 37,301,212 L77P probably damaging Het
Pcf11 T C 7: 92,649,551 D1259G probably damaging Het
Pdcl A T 2: 37,352,179 H186Q probably damaging Het
Pdzd9 A T 7: 120,662,872 *77R probably null Het
Reln C T 5: 21,899,179 E3265K probably benign Het
Smg8 T C 11: 87,077,961 T990A possibly damaging Het
Smok2a C T 17: 13,225,871 H112Y probably benign Het
Spatc1l G A 10: 76,569,408 R208H probably damaging Het
Taf7 T C 18: 37,642,680 D278G possibly damaging Het
Vipas39 T C 12: 87,242,571 N373S probably benign Het
Vmn2r78 C T 7: 86,922,350 T456I probably benign Het
Vwf T C 6: 125,566,194 S148P probably damaging Het
Wdr60 C T 12: 116,229,671 G554R possibly damaging Het
Wdr66 A G 5: 123,278,358 T565A possibly damaging Het
Xpot A C 10: 121,613,485 probably null Het
Zdbf2 A T 1: 63,308,872 R2137W probably damaging Het
Zfp462 T A 4: 55,009,544 N503K possibly damaging Het
Zfp641 T A 15: 98,293,803 M1L probably benign Het
Other mutations in Abcg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01489:Abcg2 APN 6 58685823 critical splice donor site probably null
IGL01654:Abcg2 APN 6 58683321 critical splice donor site probably null
IGL02646:Abcg2 APN 6 58685696 missense probably benign 0.01
IGL03342:Abcg2 APN 6 58665135 missense probably damaging 1.00
PIT4519001:Abcg2 UTSW 6 58674807 missense probably damaging 0.99
R0092:Abcg2 UTSW 6 58685777 missense probably benign 0.14
R0313:Abcg2 UTSW 6 58672097 missense probably benign
R0742:Abcg2 UTSW 6 58678326 missense probably benign 0.00
R1165:Abcg2 UTSW 6 58678300 missense probably benign 0.21
R1302:Abcg2 UTSW 6 58685817 missense probably damaging 1.00
R1476:Abcg2 UTSW 6 58678337 missense probably benign 0.06
R1523:Abcg2 UTSW 6 58685694 missense possibly damaging 0.96
R2056:Abcg2 UTSW 6 58690540 missense probably benign 0.20
R2057:Abcg2 UTSW 6 58690540 missense probably benign 0.20
R2153:Abcg2 UTSW 6 58684322 splice site probably null
R5636:Abcg2 UTSW 6 58672056 missense probably damaging 0.98
R5723:Abcg2 UTSW 6 58678351 nonsense probably null
R5972:Abcg2 UTSW 6 58672085 missense probably benign 0.00
R6319:Abcg2 UTSW 6 58674738 missense probably benign 0.03
R7136:Abcg2 UTSW 6 58684340 missense possibly damaging 0.67
R7387:Abcg2 UTSW 6 58689624 missense possibly damaging 0.67
X0028:Abcg2 UTSW 6 58678276 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTATACTGCTAAGCCCCTAGG -3'
(R):5'- GGGACTGCCATTTCTCAATACTG -3'

Sequencing Primer
(F):5'- CCTCTCTGTGTTAACCAGAACAG -3'
(R):5'- GACTGCCATTTCTCAATACTGTAATC -3'
Posted On2018-11-06