Incidental Mutation 'R6900:Arhgap10'
ID538490
Institutional Source Beutler Lab
Gene Symbol Arhgap10
Ensembl Gene ENSMUSG00000037148
Gene NameRho GTPase activating protein 10
SynonymsPSGAP-m, A930033B01Rik, PSGAP-s
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6900 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location77250366-77517953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77310862 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 579 (D579G)
Ref Sequence ENSEMBL: ENSMUSP00000147485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076316] [ENSMUST00000210519] [ENSMUST00000210922]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076316
AA Change: D579G

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075658
Gene: ENSMUSG00000037148
AA Change: D579G

DomainStartEndE-ValueType
Pfam:BAR_3 6 249 3.3e-91 PFAM
PH 266 374 1.93e-6 SMART
RhoGAP 393 571 1.66e-63 SMART
low complexity region 633 649 N/A INTRINSIC
SH3 731 786 1.91e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000210519
AA Change: D557G

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000210922
AA Change: D579G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit paraparesis, ataxic hindlimbs and splaying of hindlimbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cc2d2b A G 19: 40,825,074 S1333G probably null Het
Cep250 A G 2: 155,996,270 probably null Het
Chd3 T C 11: 69,354,445 D1149G possibly damaging Het
Dnah7a A G 1: 53,662,351 L215P probably damaging Het
Fbn2 T C 18: 58,076,831 M993V probably benign Het
Ggt5 A T 10: 75,610,537 Q523L possibly damaging Het
Hcn1 A G 13: 117,656,827 N205S probably benign Het
Htr1b A T 9: 81,631,570 I328N probably damaging Het
Itgav T A 2: 83,803,247 F980Y probably damaging Het
Kbtbd2 A G 6: 56,780,023 S243P probably damaging Het
Kcnd2 A G 6: 21,216,588 N97S probably damaging Het
Kif1bp T C 10: 62,559,129 Y578C probably damaging Het
Lars T C 18: 42,234,610 K468E probably benign Het
Map3k1 T C 13: 111,753,816 N1283S probably benign Het
Mapk8ip3 A T 17: 24,909,123 probably null Het
Mroh2b A G 15: 4,908,987 I253V probably benign Het
Nup98 A G 7: 102,185,962 F228S probably damaging Het
Olfr728 A T 14: 50,139,838 V267E possibly damaging Het
Pdzd2 A G 15: 12,374,037 F2004S probably benign Het
Pkhd1 A T 1: 20,534,701 L1130Q probably benign Het
Pparg G T 6: 115,472,988 R286L possibly damaging Het
Ppp1r16a A G 15: 76,691,723 S96G probably damaging Het
Psg29 C T 7: 17,204,932 Q44* probably null Het
Rgs22 A G 15: 36,010,747 F1227S possibly damaging Het
Saxo1 T C 4: 86,445,334 D304G possibly damaging Het
Sec14l1 T C 11: 117,117,223 Y12H probably damaging Het
Sh3bp4 A G 1: 89,145,767 N779S probably benign Het
Sin3a T C 9: 57,107,574 V693A probably damaging Het
Teddm1b G A 1: 153,875,210 C255Y probably benign Het
Ttk T A 9: 83,872,030 S819T probably damaging Het
Zfp362 C T 4: 128,786,015 C273Y probably damaging Het
Other mutations in Arhgap10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Arhgap10 APN 8 77346291 missense possibly damaging 0.80
IGL01689:Arhgap10 APN 8 77411134 splice site probably benign
IGL01802:Arhgap10 APN 8 77420085 missense probably damaging 0.99
IGL01832:Arhgap10 APN 8 77259129 missense probably benign 0.00
IGL02291:Arhgap10 APN 8 77382715 splice site probably benign
IGL02834:Arhgap10 APN 8 77365100 missense probably damaging 1.00
IGL02928:Arhgap10 APN 8 77250910 unclassified probably benign
IGL03149:Arhgap10 APN 8 77409538 splice site probably benign
IGL03215:Arhgap10 APN 8 77277152 missense probably benign
IGL03331:Arhgap10 APN 8 77420082 missense probably damaging 0.99
R0276:Arhgap10 UTSW 8 77413581 missense probably benign 0.11
R0376:Arhgap10 UTSW 8 77450824 splice site probably benign
R0454:Arhgap10 UTSW 8 77250965 missense probably damaging 0.97
R0714:Arhgap10 UTSW 8 77351687 splice site probably benign
R1033:Arhgap10 UTSW 8 77257347 missense possibly damaging 0.80
R1036:Arhgap10 UTSW 8 77310769 missense probably damaging 0.98
R1083:Arhgap10 UTSW 8 77517749 missense probably damaging 1.00
R1596:Arhgap10 UTSW 8 77450697 missense possibly damaging 0.93
R1710:Arhgap10 UTSW 8 77358587 nonsense probably null
R1918:Arhgap10 UTSW 8 77259079 missense probably benign
R1937:Arhgap10 UTSW 8 77344653 missense probably damaging 1.00
R1959:Arhgap10 UTSW 8 77409626 missense possibly damaging 0.78
R2348:Arhgap10 UTSW 8 77450926 splice site probably benign
R3703:Arhgap10 UTSW 8 77259056 critical splice donor site probably null
R3979:Arhgap10 UTSW 8 77420725 missense probably benign 0.01
R4854:Arhgap10 UTSW 8 77420089 nonsense probably null
R4855:Arhgap10 UTSW 8 77432738 critical splice donor site probably null
R4928:Arhgap10 UTSW 8 77426328 critical splice donor site probably null
R5033:Arhgap10 UTSW 8 77382757 missense probably damaging 0.99
R5532:Arhgap10 UTSW 8 77420072 missense probably benign 0.19
R5644:Arhgap10 UTSW 8 77411055 missense probably benign 0.00
R5781:Arhgap10 UTSW 8 77450707 missense possibly damaging 0.56
R5824:Arhgap10 UTSW 8 77358552 nonsense probably null
R5861:Arhgap10 UTSW 8 77310764 missense probably damaging 1.00
R5872:Arhgap10 UTSW 8 77344638 critical splice donor site probably null
R6360:Arhgap10 UTSW 8 77259202 nonsense probably null
R6423:Arhgap10 UTSW 8 77517757 missense probably damaging 1.00
R6694:Arhgap10 UTSW 8 77411063 missense probably benign 0.00
R6936:Arhgap10 UTSW 8 77310747 nonsense probably null
R7001:Arhgap10 UTSW 8 77365088 missense possibly damaging 0.51
R7150:Arhgap10 UTSW 8 77250954 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAGTCAACATGCCATGC -3'
(R):5'- GGCTACCTTCTTTTGGGAATGAAG -3'

Sequencing Primer
(F):5'- ATGCCATGCCACCGAGC -3'
(R):5'- GTCTGCCTCATGAGAAAAACCATTG -3'
Posted On2018-11-06