Incidental Mutation 'R6901:Ttc26'
ID538522
Institutional Source Beutler Lab
Gene Symbol Ttc26
Ensembl Gene ENSMUSG00000056832
Gene Nametetratricopeptide repeat domain 26
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.436) question?
Stock #R6901 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location38381469-38427647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38401144 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 297 (R297H)
Ref Sequence ENSEMBL: ENSMUSP00000124369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159145] [ENSMUST00000160215] [ENSMUST00000162554]
Predicted Effect probably benign
Transcript: ENSMUST00000159145
SMART Domains Protein: ENSMUSP00000124873
Gene: ENSMUSG00000056832

DomainStartEndE-ValueType
low complexity region 19 29 N/A INTRINSIC
Pfam:TPR_2 58 88 1.2e-5 PFAM
Pfam:TPR_8 58 91 1.7e-3 PFAM
Pfam:TPR_1 61 87 4.6e-4 PFAM
Pfam:TPR_11 63 113 4.9e-11 PFAM
Pfam:TPR_19 67 113 3.1e-7 PFAM
Pfam:TPR_8 89 113 2e-3 PFAM
Pfam:TPR_1 91 113 1.7e-4 PFAM
Pfam:TPR_2 91 113 2.4e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160215
SMART Domains Protein: ENSMUSP00000125097
Gene: ENSMUSG00000056832

DomainStartEndE-ValueType
low complexity region 19 29 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162554
AA Change: R297H

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124369
Gene: ENSMUSG00000056832
AA Change: R297H

DomainStartEndE-ValueType
low complexity region 19 29 N/A INTRINSIC
Pfam:TPR_2 58 88 2.7e-5 PFAM
Pfam:TPR_11 63 117 9e-9 PFAM
Pfam:TPR_9 157 227 9.2e-4 PFAM
Blast:TPR 359 392 9e-10 BLAST
Blast:TPR 461 494 8e-15 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous nonsense mutation exhibit partial prenatal lethality, a hopping gait, preaxial polydactyly, male sterility due to lack of sperm flagella, impaired hearing, and patterning defects that are typical of impaired Hedgehog signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd5 T A 9: 122,368,155 S136T probably benign Het
Anxa10 T C 8: 62,096,782 T10A probably damaging Het
Ap3b1 A G 13: 94,418,142 E262G probably benign Het
Ap3b2 T C 7: 81,484,912 probably null Het
Arhgef40 A G 14: 51,997,368 T1043A probably damaging Het
Arhgef5 T A 6: 43,273,298 S328T probably benign Het
Arid4a A G 12: 71,067,137 K166R probably damaging Het
Cdh12 A G 15: 21,583,786 I571V probably benign Het
Cdh4 G A 2: 179,860,194 V316I probably benign Het
Cebpg A T 7: 35,050,777 H20Q probably benign Het
Ces4a G A 8: 105,146,698 V392I probably benign Het
CN725425 C A 15: 91,240,763 P169T possibly damaging Het
Cyp2c54 A G 19: 40,070,259 F243S probably damaging Het
Dkk2 T A 3: 132,175,126 probably null Het
Dync2h1 A G 9: 7,131,855 Y1651H probably damaging Het
Dyrk1b T A 7: 28,185,117 L346Q probably damaging Het
Ephx4 T C 5: 107,413,561 V85A probably benign Het
Etv6 A G 6: 134,266,458 E392G probably benign Het
Fli1 T A 9: 32,429,925 N202I probably benign Het
Gm10093 A G 17: 78,492,660 E360G probably benign Het
Gpc6 G T 14: 117,951,217 R421L possibly damaging Het
Gse1 A G 8: 120,229,822 probably benign Het
Hnrnpab T C 11: 51,601,848 probably benign Het
Hyal4 A G 6: 24,756,191 E136G probably damaging Het
Kcna3 C T 3: 107,036,568 A49V probably benign Het
Krt42 C T 11: 100,269,716 M52I probably benign Het
Lyrm4 A T 13: 36,117,124 Y13N probably damaging Het
Map2 C T 1: 66,421,773 S1576L possibly damaging Het
Map3k12 G T 15: 102,500,629 P817Q possibly damaging Het
Map3k12 G T 15: 102,500,630 P817T possibly damaging Het
Masp1 T C 16: 23,513,834 K84E probably damaging Het
Mki67 A T 7: 135,708,760 probably null Het
Mrap C G 16: 90,749,305 S94C probably damaging Het
Mybpc2 C A 7: 44,505,355 C986F probably damaging Het
Nbea A C 3: 56,019,415 M789R probably damaging Het
Olfr1416 G T 1: 92,480,605 N5K probably damaging Het
Olfr694 T C 7: 106,689,189 I181V probably benign Het
Pde4a A G 9: 21,204,970 N475S probably benign Het
Pex7 C T 10: 19,860,994 V297I probably benign Het
Pkd1l3 A T 8: 109,614,614 H33L unknown Het
Prl8a6 A T 13: 27,437,047 Y67N possibly damaging Het
Rcor1 A T 12: 111,108,888 E383V probably damaging Het
Slc22a27 A T 19: 7,926,579 S64R probably damaging Het
Snx7 G A 3: 117,829,636 Q292* probably null Het
Tgm3 C T 2: 130,041,970 T516M possibly damaging Het
Trim9 T C 12: 70,346,639 E177G probably damaging Het
Ttc28 C A 5: 111,277,025 T1541N possibly damaging Het
Ttc8 T A 12: 98,961,476 L202H probably damaging Het
Ttll13 T C 7: 80,250,182 Y90H probably damaging Het
Uba1y T G Y: 825,496 I286S probably benign Het
Ubxn11 G A 4: 134,126,264 A125T probably damaging Het
Vmn1r48 A G 6: 90,036,568 Y92H possibly damaging Het
Vmn1r74 T C 7: 11,847,441 F223L probably benign Het
Vwa5b1 G A 4: 138,586,569 T696I probably benign Het
Zfp266 G T 9: 20,499,599 Y427* probably null Het
Zfp362 C T 4: 128,786,015 C273Y probably damaging Het
Zfp385c T C 11: 100,632,759 N123S probably benign Het
Zfp936 T A 7: 43,190,043 H311Q probably damaging Het
Other mutations in Ttc26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Ttc26 APN 6 38382220 splice site probably benign
IGL02049:Ttc26 APN 6 38425132 missense probably benign 0.16
IGL02403:Ttc26 APN 6 38409438 missense possibly damaging 0.95
IGL02902:Ttc26 APN 6 38425162 missense probably benign 0.21
IGL03189:Ttc26 APN 6 38425231 missense probably benign 0.00
IGL03410:Ttc26 APN 6 38385500 missense probably damaging 1.00
R0346:Ttc26 UTSW 6 38409435 missense probably damaging 1.00
R0562:Ttc26 UTSW 6 38401129 missense probably damaging 1.00
R0826:Ttc26 UTSW 6 38425114 splice site probably null
R1212:Ttc26 UTSW 6 38410793 missense probably damaging 1.00
R1778:Ttc26 UTSW 6 38409476 missense possibly damaging 0.93
R1972:Ttc26 UTSW 6 38410803 missense probably benign 0.20
R2903:Ttc26 UTSW 6 38401102 missense possibly damaging 0.61
R2904:Ttc26 UTSW 6 38401102 missense possibly damaging 0.61
R2905:Ttc26 UTSW 6 38401102 missense possibly damaging 0.61
R3788:Ttc26 UTSW 6 38403524 critical splice donor site probably null
R4222:Ttc26 UTSW 6 38395075 missense probably damaging 1.00
R4392:Ttc26 UTSW 6 38381557 start gained probably benign
R4930:Ttc26 UTSW 6 38391540 missense probably damaging 1.00
R5484:Ttc26 UTSW 6 38389122 missense probably benign 0.10
R5920:Ttc26 UTSW 6 38412070 missense probably damaging 1.00
R6229:Ttc26 UTSW 6 38395040 missense probably benign 0.22
R6429:Ttc26 UTSW 6 38398313 missense possibly damaging 0.69
X0066:Ttc26 UTSW 6 38405942 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCATGCTGCTTCGAGTTT -3'
(R):5'- TGACCCAAGAGGAAATTGACAGA -3'

Sequencing Primer
(F):5'- CTGCTTCGAGTTTACAGTGACAAGC -3'
(R):5'- CTGAGGGAAGTGGGAAGCAAC -3'
Posted On2018-11-06