Incidental Mutation 'R6903:1110034G24Rik'
List |< first << previous [record 25 of 55675] next >> last >|
ID538626
Institutional Source Beutler Lab
Gene Symbol 1110034G24Rik
Ensembl Gene ENSMUSG00000044991
Gene NameRIKEN cDNA 1110034G24 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6903 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location132686931-132751055 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 132750644 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 204 (K204*)
Ref Sequence ENSEMBL: ENSMUSP00000105759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061891] [ENSMUST00000110132] [ENSMUST00000148271]
Predicted Effect probably null
Transcript: ENSMUST00000061891
AA Change: K204*
SMART Domains Protein: ENSMUSP00000057009
Gene: ENSMUSG00000044991
AA Change: K204*

DomainStartEndE-ValueType
Pfam:DUF4521 1 206 2.3e-110 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110132
AA Change: K204*
SMART Domains Protein: ENSMUSP00000105759
Gene: ENSMUSG00000044991
AA Change: K204*

DomainStartEndE-ValueType
Pfam:DUF4521 1 204 3.4e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148271
SMART Domains Protein: ENSMUSP00000118968
Gene: ENSMUSG00000044991

DomainStartEndE-ValueType
Pfam:DUF4521 1 156 6e-80 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abca1 A T 4: 53,143,952 L15Q probably benign Het
Acsf2 T C 11: 94,559,591 M497V probably benign Het
Adnp2 T C 18: 80,130,090 N368S probably benign Het
BC034090 T C 1: 155,221,385 T656A probably benign Het
Bsph1 A G 7: 13,458,258 Y26C probably damaging Het
Cct7 T C 6: 85,466,693 F306L probably benign Het
Cd109 A G 9: 78,636,603 Q143R probably damaging Het
Cfap46 A T 7: 139,654,561 probably null Het
Col3a1 A G 1: 45,331,988 N436D probably damaging Het
Col6a3 T C 1: 90,794,207 E1498G probably damaging Het
Cyp2u1 T C 3: 131,302,775 D118G probably benign Het
Dek A G 13: 47,098,187 S51P possibly damaging Het
Dock6 C T 9: 21,809,564 G1746D probably damaging Het
Dscam T A 16: 96,820,788 N488Y probably damaging Het
Ebpl G T 14: 61,360,244 Y49* probably null Het
Eefsec C T 6: 88,446,283 G66D probably benign Het
Epha6 T A 16: 60,526,462 Y146F probably benign Het
Frmd4a A G 2: 4,586,456 R96G probably damaging Het
Gm5814 A G 17: 47,410,427 probably benign Het
Hspa13 C G 16: 75,757,984 V405L probably damaging Het
Iqgap2 A G 13: 95,661,057 V1079A probably damaging Het
Kcnj9 C A 1: 172,326,056 R167L probably damaging Het
Kdm1b T A 13: 47,074,404 D620E probably benign Het
Kif23 T C 9: 61,927,154 R442G possibly damaging Het
Nectin1 C A 9: 43,791,882 P146T possibly damaging Het
Noc4l A G 5: 110,649,595 I391T probably damaging Het
Npr1 C A 3: 90,455,145 R956L possibly damaging Het
Olfr736 T A 14: 50,393,632 M292K possibly damaging Het
Olfr740 T A 14: 50,453,955 M301K possibly damaging Het
Pcdhgb2 T C 18: 37,692,170 V738A possibly damaging Het
Ptpn20 A G 14: 33,614,504 E100G probably damaging Het
Rgs10 A G 7: 128,389,073 F97S probably damaging Het
Sirpb1a T C 3: 15,416,924 T115A probably damaging Het
Supv3l1 A G 10: 62,441,237 C251R probably damaging Het
Svopl T C 6: 38,021,608 S244G probably benign Het
Tes T C 6: 17,099,863 Y286H probably damaging Het
Tnfrsf22 G A 7: 143,639,904 probably benign Het
Vmn1r185 A G 7: 26,611,735 I115T probably damaging Het
Vmn2r-ps117 A G 17: 18,838,290 T703A possibly damaging Het
Zan T A 5: 137,456,304 I1413L unknown Het
Zc3h12d G T 10: 7,867,661 M398I probably benign Het
Zfp219 G A 14: 52,006,661 T642M probably benign Het
Zfp646 G A 7: 127,880,720 E690K possibly damaging Het
Zfr T A 15: 12,136,455 V66D unknown Het
Other mutations in 1110034G24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02207:1110034G24Rik APN 2 132691946 splice site probably benign
R0243:1110034G24Rik UTSW 2 132750639 missense probably benign 0.01
R1275:1110034G24Rik UTSW 2 132692095 missense probably benign
R2518:1110034G24Rik UTSW 2 132750527 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGCCCAGGTCATCTTCAG -3'
(R):5'- TGAGTCAGTAGCAGCCTTGG -3'

Sequencing Primer
(F):5'- AGGTCATCTTCAGCCGGGATG -3'
(R):5'- GATGCTTACTGACTCCATCACCAGG -3'
Posted On2018-11-06