Incidental Mutation 'R6903:Supv3l1'
ID538649
Institutional Source Beutler Lab
Gene Symbol Supv3l1
Ensembl Gene ENSMUSG00000020079
Gene Namesuppressor of var1, 3-like 1 (S. cerevisiae)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6903 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location62429209-62449738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62441237 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 251 (C251R)
Ref Sequence ENSEMBL: ENSMUSP00000020273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020273]
Predicted Effect probably damaging
Transcript: ENSMUST00000020273
AA Change: C251R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020273
Gene: ENSMUSG00000020079
AA Change: C251R

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 47 56 N/A INTRINSIC
HELICc 379 475 1.44e-18 SMART
Pfam:SUV3_C 625 672 4e-19 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000162023
AA Change: V255A
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.3%
Validation Efficiency 100% (46/46)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit embryonic lethality between E9.5 and E12.5. Mice homozygous for a knock-out allele exhibit embryonic lethality between E8.5 and 9.5. Mice heterozygous for this allele produce offspring with mitochondrial defects regardless of offspring genotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik A T 2: 132,750,644 K204* probably null Het
9530053A07Rik C T 7: 28,137,213 R186C probably damaging Het
Abca1 A T 4: 53,143,952 L15Q probably benign Het
Acsf2 T C 11: 94,559,591 M497V probably benign Het
Adnp2 T C 18: 80,130,090 N368S probably benign Het
BC034090 T C 1: 155,221,385 T656A probably benign Het
Bsph1 A G 7: 13,458,258 Y26C probably damaging Het
Cct7 T C 6: 85,466,693 F306L probably benign Het
Cd109 A G 9: 78,636,603 Q143R probably damaging Het
Cfap46 A T 7: 139,654,561 probably null Het
Col3a1 A G 1: 45,331,988 N436D probably damaging Het
Col6a3 T C 1: 90,794,207 E1498G probably damaging Het
Cyp2u1 T C 3: 131,302,775 D118G probably benign Het
Dek A G 13: 47,098,187 S51P possibly damaging Het
Dock6 C T 9: 21,809,564 G1746D probably damaging Het
Dscam T A 16: 96,820,788 N488Y probably damaging Het
Ebpl G T 14: 61,360,244 Y49* probably null Het
Eefsec C T 6: 88,446,283 G66D probably benign Het
Epha6 T A 16: 60,526,462 Y146F probably benign Het
Frmd4a A G 2: 4,586,456 R96G probably damaging Het
Gm5814 A G 17: 47,410,427 probably benign Het
Hspa13 C G 16: 75,757,984 V405L probably damaging Het
Iqgap2 A G 13: 95,661,057 V1079A probably damaging Het
Kcnj9 C A 1: 172,326,056 R167L probably damaging Het
Kdm1b T A 13: 47,074,404 D620E probably benign Het
Kif23 T C 9: 61,927,154 R442G possibly damaging Het
Nectin1 C A 9: 43,791,882 P146T possibly damaging Het
Noc4l A G 5: 110,649,595 I391T probably damaging Het
Npr1 C A 3: 90,455,145 R956L possibly damaging Het
Olfr736 T A 14: 50,393,632 M292K possibly damaging Het
Olfr740 T A 14: 50,453,955 M301K possibly damaging Het
Pcdhgb2 T C 18: 37,692,170 V738A possibly damaging Het
Ptpn20 A G 14: 33,614,504 E100G probably damaging Het
Rgs10 A G 7: 128,389,073 F97S probably damaging Het
Shisa6 T C 11: 66,375,156 probably null Het
Sirpb1a T C 3: 15,416,924 T115A probably damaging Het
Svopl T C 6: 38,021,608 S244G probably benign Het
Tes T C 6: 17,099,863 Y286H probably damaging Het
Tnfrsf22 G A 7: 143,639,904 probably benign Het
Vmn1r185 A G 7: 26,611,735 I115T probably damaging Het
Vmn2r-ps117 A G 17: 18,838,290 T703A possibly damaging Het
Zan T A 5: 137,456,304 I1413L unknown Het
Zc3h12d G T 10: 7,867,661 M398I probably benign Het
Zfp219 G A 14: 52,006,661 T642M probably benign Het
Zfp646 G A 7: 127,880,720 E690K possibly damaging Het
Zfr T A 15: 12,136,455 V66D unknown Het
Other mutations in Supv3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03067:Supv3l1 APN 10 62429821 missense probably damaging 1.00
R0090:Supv3l1 UTSW 10 62429706 missense probably benign 0.00
R0477:Supv3l1 UTSW 10 62430585 missense probably damaging 0.98
R0946:Supv3l1 UTSW 10 62429820 missense probably damaging 1.00
R1460:Supv3l1 UTSW 10 62443383 splice site probably benign
R1546:Supv3l1 UTSW 10 62432446 missense probably benign 0.08
R1941:Supv3l1 UTSW 10 62449612 missense probably benign
R3916:Supv3l1 UTSW 10 62449420 missense possibly damaging 0.67
R5030:Supv3l1 UTSW 10 62430615 missense probably damaging 1.00
R5040:Supv3l1 UTSW 10 62447065 missense possibly damaging 0.93
R5051:Supv3l1 UTSW 10 62443417 missense probably damaging 0.99
R5085:Supv3l1 UTSW 10 62435512 missense probably benign 0.00
R5288:Supv3l1 UTSW 10 62430596 missense possibly damaging 0.90
R5359:Supv3l1 UTSW 10 62432399 missense probably damaging 0.96
R5372:Supv3l1 UTSW 10 62432357 missense probably damaging 0.99
R5384:Supv3l1 UTSW 10 62430596 missense possibly damaging 0.90
R5385:Supv3l1 UTSW 10 62430596 missense possibly damaging 0.90
R5527:Supv3l1 UTSW 10 62429829 missense probably damaging 1.00
R5602:Supv3l1 UTSW 10 62430592 missense possibly damaging 0.81
R5713:Supv3l1 UTSW 10 62430504 missense possibly damaging 0.91
R6150:Supv3l1 UTSW 10 62435722 missense possibly damaging 0.90
R6220:Supv3l1 UTSW 10 62439021 missense possibly damaging 0.82
R6941:Supv3l1 UTSW 10 62430586 missense possibly damaging 0.86
R7187:Supv3l1 UTSW 10 62435549 missense probably damaging 1.00
R7250:Supv3l1 UTSW 10 62445067 missense probably damaging 1.00
R7438:Supv3l1 UTSW 10 62430470 critical splice donor site probably null
R7439:Supv3l1 UTSW 10 62430615 missense probably damaging 0.99
R7515:Supv3l1 UTSW 10 62432311 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAAGCACAGCAAGGTTTG -3'
(R):5'- ACAACAGAGTAGCTAGCTGTGTG -3'

Sequencing Primer
(F):5'- AAGGGGTAAGTATTTAGTCACCC -3'
(R):5'- CAGAGTAGCTAGCTGTGTGTGAGG -3'
Posted On2018-11-06