Incidental Mutation 'R6904:Oxgr1'
ID 538701
Institutional Source Beutler Lab
Gene Symbol Oxgr1
Ensembl Gene ENSMUSG00000044819
Gene Name oxoglutarate (alpha-ketoglutarate) receptor 1
Synonyms P2Y15, Cysltr3, LOC239283, Gpr99, Gpr80
MMRRC Submission 045033-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6904 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 120256997-120279847 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120259431 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 259 (I259F)
Ref Sequence ENSEMBL: ENSMUSP00000055137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058213]
AlphaFold Q6IYF8
Predicted Effect possibly damaging
Transcript: ENSMUST00000058213
AA Change: I259F

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055137
Gene: ENSMUSG00000044819
AA Change: I259F

DomainStartEndE-ValueType
Pfam:7tm_1 50 302 3.8e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor (GPCR) that belongs to the oxoglutarate receptor family within the GPCR superfamily. The encoded protein is activated by the citric acid intermediate, oxoglutarate, as well as several cysteinyl leukotrienes, including leukotrienes E4, C4 and D4, which are implicated in many inflammatory disorders. In mice, a knock-out of this gene leads to middle ear inflammation, changes in the mucosal epithelium, and an increase in fluid behind the eardrum, and is associated with hearing loss. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced leukotriene E4 ligand (LTE4)-induced ear edema at low and intermediate doses and abnormal acid-base balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,275,516 (GRCm39) Y406* probably null Het
Acadvl T C 11: 69,905,159 (GRCm39) D109G probably benign Het
Adam24 G A 8: 41,134,542 (GRCm39) G670E probably damaging Het
Angpt1 T C 15: 42,323,136 (GRCm39) M378V probably benign Het
Ankrd33 G A 15: 101,014,993 (GRCm39) probably null Het
Apol7b G A 15: 77,307,625 (GRCm39) T290I probably benign Het
Atg4a-ps A G 3: 103,553,180 (GRCm39) W54R probably damaging Het
B3glct A G 5: 149,663,069 (GRCm39) probably null Het
Bmp7 A G 2: 172,714,706 (GRCm39) S368P probably damaging Het
Boc A G 16: 44,312,154 (GRCm39) V636A probably damaging Het
Cacna1i G A 15: 80,259,002 (GRCm39) R1237H probably damaging Het
Cdcp1 T C 9: 123,002,980 (GRCm39) D697G probably benign Het
Cep85l T C 10: 53,225,194 (GRCm39) T132A probably benign Het
Ces1b T A 8: 93,787,038 (GRCm39) Y447F probably damaging Het
Cfhr4 T G 1: 139,659,391 (GRCm39) N642H possibly damaging Het
Cntn4 A T 6: 106,674,544 (GRCm39) T1015S probably benign Het
Eea1 T G 10: 95,838,741 (GRCm39) probably null Het
Fcgbpl1 C T 7: 27,836,638 (GRCm39) R186C probably damaging Het
Hipk1 A T 3: 103,684,828 (GRCm39) N262K possibly damaging Het
Jmjd8 G A 17: 26,048,026 (GRCm39) R41H possibly damaging Het
Klhl3 T A 13: 58,178,259 (GRCm39) T344S probably damaging Het
Krt39 T C 11: 99,410,647 (GRCm39) D175G probably damaging Het
Map4k1 A G 7: 28,686,227 (GRCm39) Y81C probably damaging Het
Mpdu1 T A 11: 69,549,411 (GRCm39) T95S probably benign Het
Myl12b A T 17: 71,284,135 (GRCm39) I31N probably damaging Het
Ndufaf5 T A 2: 140,030,700 (GRCm39) Y195* probably null Het
Or4c119 G A 2: 88,987,157 (GRCm39) R121C possibly damaging Het
Or4d5 T C 9: 40,012,652 (GRCm39) I45V probably benign Het
Or51v15-ps1 A T 7: 103,278,790 (GRCm39) F126I probably benign Het
Or52z12 T A 7: 103,233,727 (GRCm39) I166N possibly damaging Het
Or5w17 A G 2: 87,584,223 (GRCm39) V38A probably benign Het
Pcdhb9 T A 18: 37,534,970 (GRCm39) D321E probably benign Het
Pi4kb G T 3: 94,900,461 (GRCm39) R392L probably damaging Het
Pramel18 G A 4: 101,767,291 (GRCm39) C180Y possibly damaging Het
Prss41 T C 17: 24,056,622 (GRCm39) K151R probably benign Het
Rev3l T A 10: 39,697,477 (GRCm39) V658D probably benign Het
Snx4 A G 16: 33,115,108 (GRCm39) I430V probably damaging Het
Tanc2 C T 11: 105,726,056 (GRCm39) H407Y possibly damaging Het
Tcf25 G A 8: 124,127,437 (GRCm39) probably null Het
Tsc22d1 A T 14: 76,743,923 (GRCm39) K24* probably null Het
Vmn2r30 A G 7: 7,315,547 (GRCm39) F762S probably damaging Het
Xrcc6 A G 15: 81,913,323 (GRCm39) T319A probably benign Het
Zbtb1 C T 12: 76,432,985 (GRCm39) R324* probably null Het
Zc3h7a A G 16: 10,963,535 (GRCm39) Y729H probably damaging Het
Zfp329 C A 7: 12,540,457 (GRCm39) probably benign Het
Zfp456 A T 13: 67,514,384 (GRCm39) S441T probably benign Het
Other mutations in Oxgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02167:Oxgr1 APN 14 120,259,342 (GRCm39) missense probably damaging 0.97
IGL02678:Oxgr1 APN 14 120,259,580 (GRCm39) missense probably damaging 1.00
IGL03387:Oxgr1 APN 14 120,260,199 (GRCm39) nonsense probably null
IGL03394:Oxgr1 APN 14 120,260,022 (GRCm39) missense possibly damaging 0.65
R1615:Oxgr1 UTSW 14 120,260,185 (GRCm39) missense probably benign 0.25
R2919:Oxgr1 UTSW 14 120,260,221 (GRCm39) start gained probably benign
R4223:Oxgr1 UTSW 14 120,260,025 (GRCm39) missense probably damaging 1.00
R4409:Oxgr1 UTSW 14 120,259,572 (GRCm39) missense possibly damaging 0.67
R4783:Oxgr1 UTSW 14 120,259,776 (GRCm39) missense probably benign
R5213:Oxgr1 UTSW 14 120,259,552 (GRCm39) nonsense probably null
R5226:Oxgr1 UTSW 14 120,259,665 (GRCm39) missense probably damaging 1.00
R6416:Oxgr1 UTSW 14 120,259,860 (GRCm39) missense probably damaging 0.99
R6491:Oxgr1 UTSW 14 120,259,419 (GRCm39) missense probably benign 0.01
R6670:Oxgr1 UTSW 14 120,259,669 (GRCm39) missense probably damaging 1.00
R7089:Oxgr1 UTSW 14 120,259,614 (GRCm39) missense probably damaging 1.00
R7819:Oxgr1 UTSW 14 120,260,281 (GRCm39) critical splice acceptor site probably null
R9672:Oxgr1 UTSW 14 120,259,454 (GRCm39) missense probably damaging 1.00
R9731:Oxgr1 UTSW 14 120,260,094 (GRCm39) missense probably benign 0.00
R9803:Oxgr1 UTSW 14 120,259,563 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGCTTTGCATCTCACTATAGAGC -3'
(R):5'- CCTCACCAGTTCAGATGACCTC -3'

Sequencing Primer
(F):5'- TCTCACTATAGAGCAGAATGCCTG -3'
(R):5'- GATGACCTCACTACTATCAAGTGG -3'
Posted On 2018-11-06