Incidental Mutation 'R6905:Ankrd44'
ID538714
Institutional Source Beutler Lab
Gene Symbol Ankrd44
Ensembl Gene ENSMUSG00000052331
Gene Nameankyrin repeat domain 44
SynonymsE130014H08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R6905 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location54645340-54926387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54792494 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 50 (F50S)
Ref Sequence ENSEMBL: ENSMUSP00000137616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044359] [ENSMUST00000177679] [ENSMUST00000179030]
Predicted Effect probably damaging
Transcript: ENSMUST00000044359
AA Change: F50S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000040327
Gene: ENSMUSG00000052331
AA Change: F50S

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 5.98e1 SMART
ANK 422 451 7.13e-6 SMART
ANK 455 484 1.18e-6 SMART
ANK 488 545 1.17e2 SMART
ANK 549 579 3.31e-1 SMART
ANK 584 613 3.91e-3 SMART
ANK 617 646 1.43e-5 SMART
ANK 651 680 2.73e-2 SMART
ANK 687 716 5.41e-6 SMART
ANK 720 749 5.53e-3 SMART
ANK 753 785 1.52e0 SMART
ANK 789 819 9.27e-5 SMART
ANK 821 851 1.52e0 SMART
ANK 856 885 6.02e-4 SMART
ANK 889 919 3.08e-1 SMART
ANK 923 955 3.36e-2 SMART
ANK 959 988 6.26e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177679
AA Change: F25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137216
Gene: ENSMUSG00000052331
AA Change: F25S

DomainStartEndE-ValueType
ANK 15 44 3.23e-4 SMART
ANK 48 77 1.12e-3 SMART
ANK 81 110 1.65e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179030
AA Change: F50S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137616
Gene: ENSMUSG00000052331
AA Change: F50S

DomainStartEndE-ValueType
ANK 7 36 2.55e2 SMART
ANK 40 69 3.23e-4 SMART
ANK 73 102 1.12e-3 SMART
ANK 106 135 1.65e-1 SMART
ANK 139 168 1.6e-8 SMART
ANK 172 201 4.97e-5 SMART
ANK 205 234 1.1e-6 SMART
ANK 238 267 9.7e-8 SMART
ANK 271 301 1.11e-2 SMART
ANK 305 334 9.35e-1 SMART
ANK 338 367 2.02e-5 SMART
ANK 371 400 3.26e0 SMART
ANK 404 433 7.13e-6 SMART
ANK 437 466 1.18e-6 SMART
ANK 470 527 1.17e2 SMART
ANK 531 561 3.31e-1 SMART
ANK 566 595 3.91e-3 SMART
ANK 599 628 1.43e-5 SMART
ANK 633 662 2.73e-2 SMART
ANK 669 698 5.41e-6 SMART
ANK 702 731 5.53e-3 SMART
ANK 735 767 1.52e0 SMART
ANK 771 801 9.27e-5 SMART
ANK 803 833 1.52e0 SMART
ANK 838 867 6.02e-4 SMART
ANK 871 901 3.08e-1 SMART
ANK 905 937 3.36e-2 SMART
ANK 941 970 6.26e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.8%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik G T 1: 151,980,438 N59K probably damaging Het
Abi3bp A G 16: 56,574,517 D196G probably damaging Het
Arid4a C T 12: 71,061,544 A41V probably benign Het
Cdk11b A T 4: 155,641,608 probably benign Het
Chrm5 C A 2: 112,479,556 C405F probably benign Het
Col6a4 A T 9: 106,060,318 probably null Het
Copb1 A C 7: 114,253,890 I24S probably benign Het
Ctsh A T 9: 90,062,766 K83N probably damaging Het
Dgkd A G 1: 87,935,375 E48G probably damaging Het
Dis3l2 A G 1: 87,044,839 T657A probably benign Het
Fam166a A G 2: 25,220,479 I100V probably benign Het
Flrt1 T A 19: 7,095,392 K597* probably null Het
Ifit1bl2 T C 19: 34,619,590 S209G possibly damaging Het
Ifrd2 T C 9: 107,587,890 M1T probably null Het
Ighv8-12 T C 12: 115,648,085 Y73C probably benign Het
Klhl21 C A 4: 152,009,727 A262E probably benign Het
L3mbtl4 A T 17: 68,777,888 Y598F probably benign Het
Lad1 A G 1: 135,827,880 K298R probably benign Het
Map2k2 A G 10: 81,108,867 D71G probably damaging Het
Megf8 T A 7: 25,337,932 H752Q probably benign Het
Mms22l A T 4: 24,503,107 M200L probably benign Het
Mup5 C A 4: 61,833,103 D103Y possibly damaging Het
Nes C T 3: 87,978,678 P1371S probably damaging Het
Olfr1257 A T 2: 89,881,708 D294V probably benign Het
Olfr1315-ps1 A T 2: 112,110,358 M298K probably damaging Het
Olfr619 A T 7: 103,604,367 T238S probably benign Het
Osbpl3 T C 6: 50,351,882 I114V probably damaging Het
Pank3 T C 11: 35,776,412 Y119H probably benign Het
Pcdhb15 C T 18: 37,474,695 L327F possibly damaging Het
Pnpla8 T C 12: 44,283,553 V78A probably damaging Het
Pqlc2 A G 4: 139,306,441 probably null Het
Rbm14 A G 19: 4,803,236 probably benign Het
Rev3l G A 10: 39,817,327 V468M probably benign Het
Ripk1 A G 13: 34,027,990 I428V probably benign Het
Rps5 T C 7: 12,925,858 V147A probably damaging Het
Rps6ka2 T A 17: 7,227,941 I9N probably damaging Het
Samd9l A T 6: 3,375,387 F625I probably damaging Het
Sh3bp1 A G 15: 78,905,030 D196G probably benign Het
Smg7 A T 1: 152,850,006 probably null Het
Stap1 G A 5: 86,090,922 E150K possibly damaging Het
Ticrr T C 7: 79,665,850 I284T probably benign Het
Tm4sf1 T C 3: 57,294,909 probably benign Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Trav7d-4 G T 14: 52,770,313 A88S possibly damaging Het
Vwde T C 6: 13,205,927 E207G probably damaging Het
Other mutations in Ankrd44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Ankrd44 APN 1 54662647 splice site probably benign
IGL00839:Ankrd44 APN 1 54667435 missense probably benign 0.27
IGL01145:Ankrd44 APN 1 54762259 critical splice donor site probably null
IGL01380:Ankrd44 APN 1 54727565 missense probably benign 0.00
IGL01415:Ankrd44 APN 1 54752928 missense probably damaging 1.00
IGL01958:Ankrd44 APN 1 54766966 missense probably damaging 0.99
IGL02014:Ankrd44 APN 1 54657620 missense possibly damaging 0.95
IGL02745:Ankrd44 APN 1 54766791 missense probably damaging 1.00
IGL03008:Ankrd44 APN 1 54766809 missense probably damaging 1.00
wilderness UTSW 1 54735034 synonymous silent
PIT4812001:Ankrd44 UTSW 1 54723038 nonsense probably null
R0416:Ankrd44 UTSW 1 54743339 missense possibly damaging 0.63
R0554:Ankrd44 UTSW 1 54763758 missense probably benign 0.00
R0575:Ankrd44 UTSW 1 54762310 missense probably damaging 1.00
R1323:Ankrd44 UTSW 1 54766450 splice site probably benign
R1605:Ankrd44 UTSW 1 54828622 missense probably benign 0.36
R2032:Ankrd44 UTSW 1 54723009 splice site probably null
R4458:Ankrd44 UTSW 1 54762391 missense possibly damaging 0.92
R4610:Ankrd44 UTSW 1 54766748 intron probably benign
R4727:Ankrd44 UTSW 1 54667417 missense probably benign 0.05
R4780:Ankrd44 UTSW 1 54763757 missense probably benign 0.00
R4801:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4802:Ankrd44 UTSW 1 54762316 missense probably damaging 1.00
R4810:Ankrd44 UTSW 1 54735143 intron probably benign
R4961:Ankrd44 UTSW 1 54663912 missense probably damaging 1.00
R5053:Ankrd44 UTSW 1 54735089 nonsense probably null
R5093:Ankrd44 UTSW 1 54763718 missense probably damaging 1.00
R5155:Ankrd44 UTSW 1 54778330 missense probably benign 0.43
R5248:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
R5306:Ankrd44 UTSW 1 54926203 utr 5 prime probably benign
R5595:Ankrd44 UTSW 1 54735050 missense probably damaging 1.00
R5595:Ankrd44 UTSW 1 54762347 missense probably damaging 1.00
R6288:Ankrd44 UTSW 1 54763763 missense probably damaging 1.00
R6332:Ankrd44 UTSW 1 54762273 missense probably damaging 1.00
R6453:Ankrd44 UTSW 1 54657704 splice site probably null
R6610:Ankrd44 UTSW 1 54655087 missense probably benign 0.02
R6699:Ankrd44 UTSW 1 54762445 missense probably damaging 1.00
R7173:Ankrd44 UTSW 1 54766391 missense probably damaging 1.00
R7178:Ankrd44 UTSW 1 54649440 missense
R7219:Ankrd44 UTSW 1 54766910 missense probably damaging 1.00
R7276:Ankrd44 UTSW 1 54735080 missense probably benign 0.05
R7283:Ankrd44 UTSW 1 54729796 missense probably damaging 1.00
R7414:Ankrd44 UTSW 1 54667380 missense probably damaging 1.00
Z1088:Ankrd44 UTSW 1 54658982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCTATACAGAGTGATAGACAG -3'
(R):5'- TTGGGGAGCCATTTGTATTATCTAACC -3'

Sequencing Primer
(F):5'- GCTATACAGAGTGATAGACAGGAATC -3'
(R):5'- ACCACTTACAGAGAGGTTTCTC -3'
Posted On2018-11-06