Incidental Mutation 'R6905:Lad1'
ID538717
Institutional Source Beutler Lab
Gene Symbol Lad1
Ensembl Gene ENSMUSG00000041782
Gene Nameladinin
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6905 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location135818598-135833342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135827880 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 298 (K298R)
Ref Sequence ENSEMBL: ENSMUSP00000044630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038760]
Predicted Effect probably benign
Transcript: ENSMUST00000038760
AA Change: K298R

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044630
Gene: ENSMUSG00000041782
AA Change: K298R

DomainStartEndE-ValueType
low complexity region 16 35 N/A INTRINSIC
low complexity region 88 110 N/A INTRINSIC
low complexity region 365 377 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be an anchoring filament that is a component of basement membranes. It may contribute to the stability of the association of the epithelial layers with the underlying mesenchyme. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700025G04Rik G T 1: 151,980,438 N59K probably damaging Het
Abi3bp A G 16: 56,574,517 D196G probably damaging Het
Ankrd44 A G 1: 54,792,494 F50S probably damaging Het
Arid4a C T 12: 71,061,544 A41V probably benign Het
Cdk11b A T 4: 155,641,608 probably benign Het
Chrm5 C A 2: 112,479,556 C405F probably benign Het
Col6a4 A T 9: 106,060,318 probably null Het
Copb1 A C 7: 114,253,890 I24S probably benign Het
Ctsh A T 9: 90,062,766 K83N probably damaging Het
Dgkd A G 1: 87,935,375 E48G probably damaging Het
Dis3l2 A G 1: 87,044,839 T657A probably benign Het
Fam166a A G 2: 25,220,479 I100V probably benign Het
Flrt1 T A 19: 7,095,392 K597* probably null Het
Ifit1bl2 T C 19: 34,619,590 S209G possibly damaging Het
Ifrd2 T C 9: 107,587,890 M1T probably null Het
Ighv8-12 T C 12: 115,648,085 Y73C probably benign Het
L3mbtl4 A T 17: 68,777,888 Y598F probably benign Het
Map2k2 A G 10: 81,108,867 D71G probably damaging Het
Megf8 T A 7: 25,337,932 H752Q probably benign Het
Mms22l A T 4: 24,503,107 M200L probably benign Het
Mup5 C A 4: 61,833,103 D103Y possibly damaging Het
Nes C T 3: 87,978,678 P1371S probably damaging Het
Olfr1257 A T 2: 89,881,708 D294V probably benign Het
Olfr1315-ps1 A T 2: 112,110,358 M298K probably damaging Het
Olfr619 A T 7: 103,604,367 T238S probably benign Het
Osbpl3 T C 6: 50,351,882 I114V probably damaging Het
Pank3 T C 11: 35,776,412 Y119H probably benign Het
Pcdhb15 C T 18: 37,474,695 L327F possibly damaging Het
Pnpla8 T C 12: 44,283,553 V78A probably damaging Het
Pqlc2 A G 4: 139,306,441 probably null Het
Rbm14 A G 19: 4,803,236 probably benign Het
Rev3l G A 10: 39,817,327 V468M probably benign Het
Ripk1 A G 13: 34,027,990 I428V probably benign Het
Rps5 T C 7: 12,925,858 V147A probably damaging Het
Rps6ka2 T A 17: 7,227,941 I9N probably damaging Het
Samd9l A T 6: 3,375,387 F625I probably damaging Het
Sh3bp1 A G 15: 78,905,030 D196G probably benign Het
Smg7 A T 1: 152,850,006 probably null Het
Stap1 G A 5: 86,090,922 E150K possibly damaging Het
Ticrr T C 7: 79,665,850 I284T probably benign Het
Tm4sf1 T C 3: 57,294,909 probably benign Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Trav7d-4 G T 14: 52,770,313 A88S possibly damaging Het
Vwde T C 6: 13,205,927 E207G probably damaging Het
Other mutations in Lad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03259:Lad1 APN 1 135827656 missense probably benign 0.07
IGL03323:Lad1 APN 1 135830974 critical splice donor site probably null
R1728:Lad1 UTSW 1 135827381 missense possibly damaging 0.90
R1728:Lad1 UTSW 1 135828023 missense probably damaging 1.00
R1729:Lad1 UTSW 1 135827381 missense possibly damaging 0.90
R1729:Lad1 UTSW 1 135828023 missense probably damaging 1.00
R1730:Lad1 UTSW 1 135827381 missense possibly damaging 0.90
R1730:Lad1 UTSW 1 135828023 missense probably damaging 1.00
R1739:Lad1 UTSW 1 135827381 missense possibly damaging 0.90
R1739:Lad1 UTSW 1 135828023 missense probably damaging 1.00
R1762:Lad1 UTSW 1 135827381 missense possibly damaging 0.90
R1762:Lad1 UTSW 1 135828023 missense probably damaging 1.00
R1783:Lad1 UTSW 1 135827381 missense possibly damaging 0.90
R1783:Lad1 UTSW 1 135828023 missense probably damaging 1.00
R1784:Lad1 UTSW 1 135827381 missense possibly damaging 0.90
R1784:Lad1 UTSW 1 135828023 missense probably damaging 1.00
R1785:Lad1 UTSW 1 135827381 missense possibly damaging 0.90
R1785:Lad1 UTSW 1 135828023 missense probably damaging 1.00
R1837:Lad1 UTSW 1 135829706 missense probably benign 0.00
R1854:Lad1 UTSW 1 135827730 missense probably damaging 0.99
R4066:Lad1 UTSW 1 135827427 missense probably damaging 1.00
R4240:Lad1 UTSW 1 135827295 missense possibly damaging 0.84
R4414:Lad1 UTSW 1 135828746 missense probably benign 0.06
R4415:Lad1 UTSW 1 135828746 missense probably benign 0.06
R4417:Lad1 UTSW 1 135828746 missense probably benign 0.06
R4770:Lad1 UTSW 1 135825793 missense probably damaging 1.00
R6419:Lad1 UTSW 1 135831892 missense possibly damaging 0.86
R6824:Lad1 UTSW 1 135827741 missense probably benign 0.04
X0024:Lad1 UTSW 1 135830933 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATAGCCCAGAGAAGTTGGTTC -3'
(R):5'- AATGCCAACCTGGAGTGTGATG -3'

Sequencing Primer
(F):5'- TGACAGAGAAGTCACCGGTCC -3'
(R):5'- AACCTGGAGTGTGATGGGTGG -3'
Posted On2018-11-06