Incidental Mutation 'R6906:Sis'
ID 538765
Institutional Source Beutler Lab
Gene Symbol Sis
Ensembl Gene ENSMUSG00000027790
Gene Name sucrase isomaltase
Synonyms 2010204N08Rik, Si-s, sucrase-isomaltase
MMRRC Submission 044998-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6906 (G1)
Quality Score 147.008
Status Validated
Chromosome 3
Chromosomal Location 72795890-72875196 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 72826818 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1287 (L1287P)
Ref Sequence ENSEMBL: ENSMUSP00000129116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]
AlphaFold F8VQM5
Predicted Effect probably damaging
Transcript: ENSMUST00000094190
AA Change: L1287P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: L1287P

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167334
AA Change: L1287P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: L1287P

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf2 A G 5: 24,773,840 (GRCm39) F350L possibly damaging Het
Ahnak2 T A 12: 112,748,933 (GRCm39) T305S probably benign Het
Anp32a A G 9: 62,284,851 (GRCm39) probably benign Het
Aplf A G 6: 87,607,068 (GRCm39) S449P possibly damaging Het
Arl6ip4 A G 5: 124,254,614 (GRCm39) R36G possibly damaging Het
Ascc1 G A 10: 59,840,674 (GRCm39) D12N probably benign Het
Bin1 C A 18: 32,554,978 (GRCm39) H243Q probably benign Het
Ccdc168 C T 1: 44,095,173 (GRCm39) S1975N probably benign Het
Ccdc7a C A 8: 129,662,162 (GRCm39) V547L unknown Het
Cntnap5c T A 17: 58,702,302 (GRCm39) N1207K probably benign Het
Coro7 C A 16: 4,451,168 (GRCm39) R507L probably benign Het
Crtap T A 9: 114,210,700 (GRCm39) K291N probably benign Het
Csmd3 T C 15: 47,710,569 (GRCm39) T1569A probably benign Het
Dmrta1 A G 4: 89,580,203 (GRCm39) T388A probably benign Het
Ehd3 T C 17: 74,137,333 (GRCm39) F501L probably damaging Het
Fbn2 A C 18: 58,204,891 (GRCm39) L1184R possibly damaging Het
Fhip1b G A 7: 105,037,476 (GRCm39) T369I probably damaging Het
Hsf1 T C 15: 76,361,919 (GRCm39) probably null Het
Hycc1 A T 5: 24,204,956 (GRCm39) W12R probably damaging Het
Kansl1l T C 1: 66,762,437 (GRCm39) H810R possibly damaging Het
Lrp5 A T 19: 3,672,638 (GRCm39) I557N probably damaging Het
Lypd1 T C 1: 125,838,196 (GRCm39) E41G probably damaging Het
Mgam A G 6: 40,724,853 (GRCm39) Y443C probably damaging Het
Muc2 A G 7: 141,284,976 (GRCm39) D871G probably damaging Het
Nup85 T A 11: 115,471,769 (GRCm39) Y198N probably damaging Het
Obscn T A 11: 58,923,744 (GRCm39) M6578L possibly damaging Het
Or8h7 T C 2: 86,721,091 (GRCm39) T143A probably benign Het
Osbpl5 G C 7: 143,248,065 (GRCm39) Q667E probably damaging Het
Ovgp1 T A 3: 105,894,189 (GRCm39) probably benign Het
Prl8a2 T A 13: 27,532,900 (GRCm39) N37K probably benign Het
Ptprf A T 4: 118,126,474 (GRCm39) I93N possibly damaging Het
Rnf112 T C 11: 61,341,215 (GRCm39) S457G probably null Het
Sema3e A G 5: 14,290,601 (GRCm39) D562G probably damaging Het
Sesn3 A G 9: 14,236,937 (GRCm39) M472V probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 126,915,419 (GRCm39) probably benign Het
Shc3 T C 13: 51,620,595 (GRCm39) T144A probably damaging Het
Srrm2 C T 17: 24,039,337 (GRCm39) P2090S probably damaging Het
Syne2 T G 12: 76,042,760 (GRCm39) D3910E possibly damaging Het
Tcaim C T 9: 122,663,839 (GRCm39) T443I probably benign Het
Tex19.1 T C 11: 121,037,948 (GRCm39) V102A probably benign Het
Tpd52l1 T G 10: 31,208,950 (GRCm39) T168P possibly damaging Het
Trdn G A 10: 33,109,944 (GRCm39) C294Y probably benign Het
Trmt1l T C 1: 151,327,926 (GRCm39) Y479H probably benign Het
Vmn1r171 G A 7: 23,331,804 (GRCm39) V10I probably benign Het
Zbtb41 T A 1: 139,351,128 (GRCm39) D80E possibly damaging Het
Zcchc4 A G 5: 52,980,976 (GRCm39) K473E possibly damaging Het
Other mutations in Sis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Sis APN 3 72,853,969 (GRCm39) missense probably benign
IGL00715:Sis APN 3 72,841,457 (GRCm39) missense probably damaging 1.00
IGL00721:Sis APN 3 72,850,912 (GRCm39) missense probably damaging 1.00
IGL00766:Sis APN 3 72,814,570 (GRCm39) splice site probably benign
IGL00783:Sis APN 3 72,853,965 (GRCm39) missense probably benign
IGL00805:Sis APN 3 72,841,532 (GRCm39) missense probably benign 0.05
IGL00932:Sis APN 3 72,848,289 (GRCm39) splice site probably benign
IGL01020:Sis APN 3 72,874,171 (GRCm39) missense probably damaging 1.00
IGL01024:Sis APN 3 72,819,209 (GRCm39) missense probably damaging 1.00
IGL01286:Sis APN 3 72,848,358 (GRCm39) missense probably damaging 1.00
IGL01457:Sis APN 3 72,868,354 (GRCm39) missense probably benign
IGL01514:Sis APN 3 72,843,253 (GRCm39) splice site probably benign
IGL01986:Sis APN 3 72,852,545 (GRCm39) missense probably damaging 1.00
IGL02110:Sis APN 3 72,836,032 (GRCm39) nonsense probably null
IGL02132:Sis APN 3 72,854,804 (GRCm39) missense probably benign 0.00
IGL02152:Sis APN 3 72,796,319 (GRCm39) utr 3 prime probably benign
IGL02200:Sis APN 3 72,850,937 (GRCm39) missense probably damaging 0.99
IGL02244:Sis APN 3 72,863,523 (GRCm39) missense probably benign 0.19
IGL02307:Sis APN 3 72,819,167 (GRCm39) splice site probably benign
IGL02374:Sis APN 3 72,832,789 (GRCm39) missense probably benign 0.03
IGL02437:Sis APN 3 72,826,947 (GRCm39) critical splice acceptor site probably null
IGL02571:Sis APN 3 72,863,637 (GRCm39) splice site probably benign
IGL02601:Sis APN 3 72,820,543 (GRCm39) missense probably benign 0.44
IGL03063:Sis APN 3 72,835,630 (GRCm39) missense probably benign
IGL03382:Sis APN 3 72,836,052 (GRCm39) missense probably benign 0.00
IGL03397:Sis APN 3 72,843,212 (GRCm39) missense probably benign 0.44
PIT1430001:Sis UTSW 3 72,830,162 (GRCm39) missense probably damaging 0.97
R0013:Sis UTSW 3 72,817,809 (GRCm39) missense possibly damaging 0.65
R0013:Sis UTSW 3 72,817,809 (GRCm39) missense possibly damaging 0.65
R0046:Sis UTSW 3 72,839,427 (GRCm39) missense probably benign 0.01
R0094:Sis UTSW 3 72,828,770 (GRCm39) missense probably damaging 1.00
R0096:Sis UTSW 3 72,835,600 (GRCm39) missense probably damaging 1.00
R0505:Sis UTSW 3 72,867,629 (GRCm39) missense probably benign 0.29
R0544:Sis UTSW 3 72,858,975 (GRCm39) missense probably damaging 1.00
R0551:Sis UTSW 3 72,832,740 (GRCm39) missense possibly damaging 0.79
R0617:Sis UTSW 3 72,872,938 (GRCm39) missense probably damaging 1.00
R0698:Sis UTSW 3 72,817,831 (GRCm39) missense probably damaging 1.00
R0701:Sis UTSW 3 72,848,378 (GRCm39) missense probably damaging 1.00
R0704:Sis UTSW 3 72,857,155 (GRCm39) missense possibly damaging 0.63
R0706:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0710:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0752:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0753:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0754:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0767:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0769:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0772:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0774:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0776:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0818:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0819:Sis UTSW 3 72,859,864 (GRCm39) missense probably damaging 1.00
R0885:Sis UTSW 3 72,819,282 (GRCm39) nonsense probably null
R1076:Sis UTSW 3 72,841,431 (GRCm39) missense probably damaging 0.97
R1140:Sis UTSW 3 72,858,949 (GRCm39) missense probably damaging 0.98
R1175:Sis UTSW 3 72,865,437 (GRCm39) splice site probably benign
R1301:Sis UTSW 3 72,853,915 (GRCm39) missense possibly damaging 0.76
R1437:Sis UTSW 3 72,841,475 (GRCm39) missense probably damaging 1.00
R1466:Sis UTSW 3 72,839,393 (GRCm39) missense possibly damaging 0.60
R1466:Sis UTSW 3 72,839,393 (GRCm39) missense possibly damaging 0.60
R1472:Sis UTSW 3 72,796,360 (GRCm39) missense probably benign 0.12
R1584:Sis UTSW 3 72,839,393 (GRCm39) missense possibly damaging 0.60
R1707:Sis UTSW 3 72,816,420 (GRCm39) splice site probably benign
R1715:Sis UTSW 3 72,796,343 (GRCm39) missense possibly damaging 0.47
R1719:Sis UTSW 3 72,872,937 (GRCm39) missense probably damaging 1.00
R1728:Sis UTSW 3 72,872,978 (GRCm39) nonsense probably null
R1784:Sis UTSW 3 72,872,978 (GRCm39) nonsense probably null
R1820:Sis UTSW 3 72,828,475 (GRCm39) missense probably damaging 1.00
R1972:Sis UTSW 3 72,828,337 (GRCm39) missense probably damaging 1.00
R1973:Sis UTSW 3 72,828,337 (GRCm39) missense probably damaging 1.00
R2054:Sis UTSW 3 72,820,570 (GRCm39) missense probably benign 0.01
R2233:Sis UTSW 3 72,820,527 (GRCm39) missense probably benign 0.03
R2235:Sis UTSW 3 72,820,527 (GRCm39) missense probably benign 0.03
R2276:Sis UTSW 3 72,821,934 (GRCm39) nonsense probably null
R2435:Sis UTSW 3 72,819,237 (GRCm39) missense probably benign 0.01
R2885:Sis UTSW 3 72,816,506 (GRCm39) missense probably benign 0.01
R2966:Sis UTSW 3 72,796,343 (GRCm39) missense probably benign 0.30
R3708:Sis UTSW 3 72,850,856 (GRCm39) missense probably benign 0.02
R3790:Sis UTSW 3 72,828,747 (GRCm39) missense probably damaging 1.00
R3807:Sis UTSW 3 72,832,929 (GRCm39) missense probably benign 0.01
R3858:Sis UTSW 3 72,835,985 (GRCm39) missense probably damaging 0.99
R3974:Sis UTSW 3 72,850,968 (GRCm39) missense probably damaging 0.96
R3975:Sis UTSW 3 72,850,968 (GRCm39) missense probably damaging 0.96
R4037:Sis UTSW 3 72,835,935 (GRCm39) missense probably benign
R4080:Sis UTSW 3 72,828,517 (GRCm39) missense probably damaging 1.00
R4204:Sis UTSW 3 72,868,415 (GRCm39) missense probably benign
R4394:Sis UTSW 3 72,863,482 (GRCm39) missense probably damaging 1.00
R4470:Sis UTSW 3 72,835,492 (GRCm39) splice site probably null
R4573:Sis UTSW 3 72,835,570 (GRCm39) missense possibly damaging 0.94
R4868:Sis UTSW 3 72,850,881 (GRCm39) missense probably benign 0.09
R5023:Sis UTSW 3 72,841,455 (GRCm39) missense probably benign 0.05
R5264:Sis UTSW 3 72,857,089 (GRCm39) missense probably damaging 0.98
R5414:Sis UTSW 3 72,859,826 (GRCm39) missense probably benign
R5462:Sis UTSW 3 72,857,171 (GRCm39) missense probably damaging 0.96
R5523:Sis UTSW 3 72,798,754 (GRCm39) missense probably benign 0.00
R5584:Sis UTSW 3 72,817,748 (GRCm39) missense probably damaging 1.00
R5587:Sis UTSW 3 72,821,909 (GRCm39) missense possibly damaging 0.94
R5725:Sis UTSW 3 72,872,931 (GRCm39) missense probably damaging 1.00
R5769:Sis UTSW 3 72,835,568 (GRCm39) missense probably damaging 0.98
R5790:Sis UTSW 3 72,835,507 (GRCm39) missense probably benign
R5864:Sis UTSW 3 72,857,151 (GRCm39) missense probably damaging 1.00
R5902:Sis UTSW 3 72,867,589 (GRCm39) critical splice donor site probably null
R5925:Sis UTSW 3 72,828,713 (GRCm39) splice site probably null
R6018:Sis UTSW 3 72,820,525 (GRCm39) missense possibly damaging 0.95
R6029:Sis UTSW 3 72,835,641 (GRCm39) missense probably benign 0.30
R6124:Sis UTSW 3 72,860,544 (GRCm39) missense possibly damaging 0.69
R6171:Sis UTSW 3 72,868,360 (GRCm39) missense possibly damaging 0.75
R6182:Sis UTSW 3 72,811,626 (GRCm39) missense probably benign 0.05
R6295:Sis UTSW 3 72,874,103 (GRCm39) missense probably damaging 0.99
R6416:Sis UTSW 3 72,819,187 (GRCm39) missense probably damaging 1.00
R6431:Sis UTSW 3 72,865,507 (GRCm39) missense probably benign 0.00
R6472:Sis UTSW 3 72,846,067 (GRCm39) nonsense probably null
R6517:Sis UTSW 3 72,814,475 (GRCm39) missense probably damaging 1.00
R6701:Sis UTSW 3 72,856,860 (GRCm39) missense probably damaging 1.00
R6796:Sis UTSW 3 72,872,951 (GRCm39) missense probably benign 0.06
R6853:Sis UTSW 3 72,798,759 (GRCm39) missense possibly damaging 0.93
R7058:Sis UTSW 3 72,810,940 (GRCm39) missense probably damaging 0.98
R7357:Sis UTSW 3 72,832,404 (GRCm39) missense probably damaging 1.00
R7381:Sis UTSW 3 72,820,625 (GRCm39) splice site probably null
R7439:Sis UTSW 3 72,816,374 (GRCm39) missense possibly damaging 0.81
R7742:Sis UTSW 3 72,832,431 (GRCm39) missense probably benign 0.19
R7813:Sis UTSW 3 72,832,801 (GRCm39) missense probably benign 0.01
R7883:Sis UTSW 3 72,828,329 (GRCm39) missense possibly damaging 0.78
R7899:Sis UTSW 3 72,844,584 (GRCm39) missense probably damaging 1.00
R7915:Sis UTSW 3 72,828,471 (GRCm39) missense probably damaging 0.99
R7985:Sis UTSW 3 72,844,294 (GRCm39) splice site probably null
R8020:Sis UTSW 3 72,816,298 (GRCm39) critical splice donor site probably null
R8023:Sis UTSW 3 72,859,813 (GRCm39) missense probably damaging 0.97
R8029:Sis UTSW 3 72,828,475 (GRCm39) missense probably damaging 1.00
R8053:Sis UTSW 3 72,856,901 (GRCm39) nonsense probably null
R8062:Sis UTSW 3 72,828,321 (GRCm39) nonsense probably null
R8074:Sis UTSW 3 72,824,531 (GRCm39) missense probably damaging 1.00
R8085:Sis UTSW 3 72,814,462 (GRCm39) missense probably damaging 1.00
R8137:Sis UTSW 3 72,796,378 (GRCm39) missense probably benign 0.22
R8349:Sis UTSW 3 72,810,984 (GRCm39) missense probably damaging 1.00
R8354:Sis UTSW 3 72,854,834 (GRCm39) missense possibly damaging 0.84
R8366:Sis UTSW 3 72,865,566 (GRCm39) missense probably damaging 1.00
R8449:Sis UTSW 3 72,810,984 (GRCm39) missense probably damaging 1.00
R8454:Sis UTSW 3 72,854,834 (GRCm39) missense possibly damaging 0.84
R8474:Sis UTSW 3 72,836,730 (GRCm39) missense probably damaging 1.00
R8515:Sis UTSW 3 72,836,742 (GRCm39) missense probably benign 0.00
R8680:Sis UTSW 3 72,867,628 (GRCm39) missense probably damaging 1.00
R8703:Sis UTSW 3 72,867,657 (GRCm39) missense probably damaging 1.00
R9098:Sis UTSW 3 72,844,578 (GRCm39) missense possibly damaging 0.66
R9466:Sis UTSW 3 72,872,910 (GRCm39) critical splice donor site probably null
R9574:Sis UTSW 3 72,828,490 (GRCm39) missense probably benign 0.05
R9630:Sis UTSW 3 72,828,722 (GRCm39) missense probably benign 0.11
R9680:Sis UTSW 3 72,863,621 (GRCm39) missense probably benign 0.12
R9709:Sis UTSW 3 72,799,074 (GRCm39) missense possibly damaging 0.47
R9731:Sis UTSW 3 72,835,543 (GRCm39) missense probably benign 0.01
X0009:Sis UTSW 3 72,796,355 (GRCm39) missense probably damaging 0.99
X0024:Sis UTSW 3 72,836,003 (GRCm39) missense probably benign
X0060:Sis UTSW 3 72,828,239 (GRCm39) intron probably benign
Z1176:Sis UTSW 3 72,850,890 (GRCm39) missense probably benign 0.25
Z1176:Sis UTSW 3 72,811,606 (GRCm39) missense probably benign 0.05
Z1177:Sis UTSW 3 72,850,902 (GRCm39) missense probably damaging 1.00
Z1177:Sis UTSW 3 72,817,807 (GRCm39) missense probably damaging 1.00
Z1177:Sis UTSW 3 72,816,505 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTAGCCGGAAATAGCCCAAG -3'
(R):5'- AGCCTCCAAAGTGCTCTTC -3'

Sequencing Primer
(F):5'- ACTGCCATGGGTGCTGAAG -3'
(R):5'- TCCAAAGTGCTCTTCCAAATTG -3'
Posted On 2018-11-06