Incidental Mutation 'R6907:Ctr9'
ID538821
Institutional Source Beutler Lab
Gene Symbol Ctr9
Ensembl Gene ENSMUSG00000005609
Gene NameCTR9 homolog, Paf1/RNA polymerase II complex component
SynonymsTsbp, Tsp, Sh2bp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6907 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location111028951-111056377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111030242 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 25 (P25L)
Ref Sequence ENSEMBL: ENSMUSP00000005749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005749]
Predicted Effect probably damaging
Transcript: ENSMUST00000005749
AA Change: P25L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005749
Gene: ENSMUSG00000005609
AA Change: P25L

DomainStartEndE-ValueType
TPR 163 196 2.26e-3 SMART
TPR 198 231 2e-4 SMART
low complexity region 232 241 N/A INTRINSIC
TPR 306 339 4.52e-3 SMART
TPR 341 374 1.39e-3 SMART
TPR 451 484 3.56e-1 SMART
TPR 497 530 7.34e-3 SMART
TPR 531 564 3.24e-4 SMART
Blast:TPR 565 598 2e-14 BLAST
TPR 681 714 9.03e-3 SMART
TPR 717 750 1.6e1 SMART
coiled coil region 828 889 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
low complexity region 923 928 N/A INTRINSIC
low complexity region 932 1002 N/A INTRINSIC
low complexity region 1005 1028 N/A INTRINSIC
low complexity region 1034 1050 N/A INTRINSIC
low complexity region 1072 1090 N/A INTRINSIC
low complexity region 1133 1159 N/A INTRINSIC
Meta Mutation Damage Score 0.44 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the PAF1 complex, which associates with RNA polymerase II and functions in transcriptional regulation and elongation. This complex also plays a role in the modification of histones. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 T C 8: 111,972,161 I344V probably benign Het
Bmper A T 9: 23,399,572 Q434L probably damaging Het
Cabyr A G 18: 12,750,912 Y152C probably benign Het
Cactin G A 10: 81,323,444 probably null Het
Cadps2 T C 6: 23,599,506 D238G probably damaging Het
Card10 T C 15: 78,787,471 T598A possibly damaging Het
Entpd5 T C 12: 84,377,353 T409A probably benign Het
Exd1 A G 2: 119,533,476 V137A probably damaging Het
Fcgbp G A 7: 28,085,018 G168R probably damaging Het
Ift88 A G 14: 57,445,610 N248S probably benign Het
Kntc1 T A 5: 123,801,825 Y1561N probably damaging Het
Mef2c A G 13: 83,654,611 D227G probably benign Het
Myh2 C T 11: 67,193,741 T1702M probably damaging Het
Myo1e T A 9: 70,327,155 N263K probably benign Het
Nfe2l1 A G 11: 96,819,810 L373P probably damaging Het
Nob1 C T 8: 107,416,228 V274M possibly damaging Het
Ntng2 A G 2: 29,228,206 C77R probably damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr288 T C 15: 98,187,768 N10D probably damaging Het
Olfr476 T C 7: 107,968,252 L285P probably damaging Het
Pcdh7 T A 5: 57,719,129 W9R possibly damaging Het
Pcdha1 A G 18: 36,931,071 T263A probably benign Het
Per3 C T 4: 151,043,558 probably null Het
Pgbd5 A G 8: 124,380,282 F265L probably damaging Het
Ppm1k T G 6: 57,510,770 E356A probably benign Het
Ptgfr G T 3: 151,835,301 T190K possibly damaging Het
Sec24a A G 11: 51,712,276 Y782H probably damaging Het
Setd1b T C 5: 123,163,232 probably benign Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc19a2 C T 1: 164,262,754 T253I possibly damaging Het
Tcf4 C T 18: 69,652,413 T207M probably damaging Het
Thada T C 17: 84,393,469 N1203S probably damaging Het
Tln2 A T 9: 67,397,635 S5T probably damaging Het
Traf4 C T 11: 78,160,442 R296Q probably benign Het
Ttbk2 A G 2: 120,825,270 S38P probably benign Het
Vrk1 G T 12: 106,075,032 Q395H possibly damaging Het
Vwa3a G T 7: 120,792,581 probably benign Het
Wdsub1 C T 2: 59,861,684 V335I possibly damaging Het
Other mutations in Ctr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Ctr9 APN 7 111049331 missense probably damaging 1.00
IGL02379:Ctr9 APN 7 111051519 missense probably damaging 0.99
IGL02451:Ctr9 APN 7 111043424 nonsense probably null
IGL03222:Ctr9 APN 7 111043050 missense probably benign 0.41
R0023:Ctr9 UTSW 7 111043947 missense possibly damaging 0.83
R0023:Ctr9 UTSW 7 111043947 missense possibly damaging 0.83
R0586:Ctr9 UTSW 7 111049498 splice site probably benign
R0761:Ctr9 UTSW 7 111046272 missense probably damaging 0.97
R0834:Ctr9 UTSW 7 111050952 missense probably benign 0.06
R1593:Ctr9 UTSW 7 111042853 missense possibly damaging 0.82
R1711:Ctr9 UTSW 7 111055663 missense unknown
R1828:Ctr9 UTSW 7 111043958 synonymous probably null
R1838:Ctr9 UTSW 7 111052303 missense possibly damaging 0.93
R2037:Ctr9 UTSW 7 111046807 missense probably benign 0.04
R2171:Ctr9 UTSW 7 111046910 missense possibly damaging 0.69
R2512:Ctr9 UTSW 7 111046871 missense probably damaging 1.00
R2850:Ctr9 UTSW 7 111053446 missense unknown
R2851:Ctr9 UTSW 7 111053446 missense unknown
R3124:Ctr9 UTSW 7 111053446 missense unknown
R4049:Ctr9 UTSW 7 111055543 missense unknown
R4280:Ctr9 UTSW 7 111046723 intron probably benign
R4350:Ctr9 UTSW 7 111049318 missense probably damaging 1.00
R4352:Ctr9 UTSW 7 111049318 missense probably damaging 1.00
R4460:Ctr9 UTSW 7 111046894 missense probably benign 0.01
R4740:Ctr9 UTSW 7 111035371 missense probably benign 0.31
R5039:Ctr9 UTSW 7 111042857 missense probably benign 0.28
R5216:Ctr9 UTSW 7 111045458 missense possibly damaging 0.68
R5647:Ctr9 UTSW 7 111055544 missense unknown
R5677:Ctr9 UTSW 7 111044002 missense probably benign 0.45
Z1088:Ctr9 UTSW 7 111030224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTACAACCTGTTTGCCATGTG -3'
(R):5'- GGGAAACTGACCTTACTGTTCC -3'

Sequencing Primer
(F):5'- TTGCCATGTGTTTCCTAAATAGG -3'
(R):5'- TGCCATCACAGTCCTGGAAGTAG -3'
Posted On2018-11-06