Incidental Mutation 'R6908:Serinc4'
ID538852
Institutional Source Beutler Lab
Gene Symbol Serinc4
Ensembl Gene ENSMUSG00000046110
Gene Nameserine incorporator 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6908 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location121439059-121456781 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121453605 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 310 (T310I)
Ref Sequence ENSEMBL: ENSMUSP00000051261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056312] [ENSMUST00000099475] [ENSMUST00000110612] [ENSMUST00000110613] [ENSMUST00000110615] [ENSMUST00000126764] [ENSMUST00000139253] [ENSMUST00000148575] [ENSMUST00000154418]
Predicted Effect probably benign
Transcript: ENSMUST00000056312
AA Change: T310I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051261
Gene: ENSMUSG00000046110
AA Change: T310I

DomainStartEndE-ValueType
Pfam:Serinc 33 488 3e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099475
SMART Domains Protein: ENSMUSP00000097074
Gene: ENSMUSG00000074884

DomainStartEndE-ValueType
Pfam:4F5 1 38 3.1e-14 PFAM
low complexity region 49 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110612
SMART Domains Protein: ENSMUSP00000106242
Gene: ENSMUSG00000027245

DomainStartEndE-ValueType
coiled coil region 69 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110613
SMART Domains Protein: ENSMUSP00000106243
Gene: ENSMUSG00000046110

DomainStartEndE-ValueType
Pfam:Serinc 34 280 5.6e-67 PFAM
low complexity region 342 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110615
Predicted Effect probably benign
Transcript: ENSMUST00000126764
SMART Domains Protein: ENSMUSP00000117946
Gene: ENSMUSG00000027245

DomainStartEndE-ValueType
coiled coil region 69 111 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000127435
SMART Domains Protein: ENSMUSP00000119373
Gene: ENSMUSG00000046110

DomainStartEndE-ValueType
Pfam:Serinc 2 192 7.7e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139253
SMART Domains Protein: ENSMUSP00000123181
Gene: ENSMUSG00000074884

DomainStartEndE-ValueType
Pfam:4F5 1 38 1e-14 PFAM
low complexity region 45 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140135
SMART Domains Protein: ENSMUSP00000117054
Gene: ENSMUSG00000046110

DomainStartEndE-ValueType
Pfam:Serinc 1 75 8.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140752
SMART Domains Protein: ENSMUSP00000116676
Gene: ENSMUSG00000046110

DomainStartEndE-ValueType
Pfam:Serinc 2 78 7.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148575
SMART Domains Protein: ENSMUSP00000121895
Gene: ENSMUSG00000074884

DomainStartEndE-ValueType
Pfam:4F5 1 38 2.9e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154418
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 95% (52/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,657,305 I1197T probably benign Het
Atp2a1 A G 7: 126,448,535 probably null Het
B3glct T C 5: 149,696,476 probably null Het
Bbs9 T G 9: 22,567,723 I154S probably damaging Het
Brip1 T C 11: 86,077,884 Y825C probably damaging Het
Ccdc186 A T 19: 56,791,939 probably null Het
Celf6 T C 9: 59,603,823 V349A probably benign Het
Chd9 A G 8: 90,956,416 T495A probably benign Het
Cxxc1 G A 18: 74,220,559 C546Y probably damaging Het
Cxxc5 T C 18: 35,859,215 V223A probably damaging Het
Dlc1 A G 8: 36,937,687 F316S probably benign Het
Dnajc12 C A 10: 63,397,325 Q82K probably benign Het
Dock8 G A 19: 25,188,382 E1877K probably damaging Het
Epha3 T G 16: 63,598,249 H611P probably damaging Het
Fpr-rs6 C A 17: 20,182,439 C220F probably damaging Het
Fryl A G 5: 73,022,211 L2951P probably damaging Het
Gbp10 T G 5: 105,221,032 T314P probably damaging Het
Hbb-bs T C 7: 103,827,534 N77D probably benign Het
Ints13 A T 6: 146,555,033 D438E probably damaging Het
Itgb6 C T 2: 60,650,021 V324M probably benign Het
Kdm7a G T 6: 39,144,439 L861M possibly damaging Het
Kirrel3 A G 9: 35,013,401 T302A possibly damaging Het
Lama2 A T 10: 27,031,196 probably null Het
Lrp2 A T 2: 69,472,365 C3007S probably damaging Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Mastl T C 2: 23,155,976 probably benign Het
Mcf2l T C 8: 13,018,919 V1087A probably benign Het
Mcmdc2 C A 1: 9,930,778 probably null Het
Ms4a3 A G 19: 11,638,295 I39T probably damaging Het
Mylk T G 16: 34,880,273 C495G probably benign Het
Myo10 A G 15: 25,804,383 D1588G probably damaging Het
Myo15 A T 11: 60,506,006 T2634S probably damaging Het
Nlrp1b T C 11: 71,217,296 I460V probably benign Het
Nmt1 T G 11: 103,058,254 S312A possibly damaging Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr710 T C 7: 106,944,632 Y123C possibly damaging Het
Paxip1 T C 5: 27,791,224 Y19C possibly damaging Het
Pcdhb2 G T 18: 37,296,524 A517S probably damaging Het
Pkd2l1 A G 19: 44,152,446 I559T probably damaging Het
Plec G A 15: 76,185,881 Q806* probably null Het
Prss51 C T 14: 64,096,152 A70V probably benign Het
Psd3 A T 8: 67,964,177 I356K probably benign Het
Ptprn2 A T 12: 116,888,888 I522F probably benign Het
Rab39 T C 9: 53,706,069 D16G probably damaging Het
Ralgps1 T C 2: 33,143,100 Q439R probably benign Het
Rapgef2 A T 3: 79,104,063 D238E probably benign Het
Ripor2 G A 13: 24,706,232 G697S probably damaging Het
Scn11a A T 9: 119,792,426 F642I probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Slc36a3 T C 11: 55,149,886 probably benign Het
Smc1b A G 15: 85,107,010 S656P probably damaging Het
Sorbs1 A G 19: 40,352,332 S455P probably damaging Het
Ttn C A 2: 76,889,858 probably benign Het
Tyw5 T C 1: 57,401,523 R27G probably damaging Het
Vmn1r209 T C 13: 22,806,230 T97A possibly damaging Het
Other mutations in Serinc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Serinc4 APN 2 121454991 missense probably damaging 1.00
IGL02720:Serinc4 APN 2 121452427 missense probably benign 0.11
IGL03036:Serinc4 APN 2 121439558 splice site probably benign
IGL03192:Serinc4 APN 2 121452391 nonsense probably null
R2434:Serinc4 UTSW 2 121455705 missense probably benign 0.00
R4897:Serinc4 UTSW 2 121452424 missense probably damaging 1.00
R5378:Serinc4 UTSW 2 121452380 missense possibly damaging 0.96
R6854:Serinc4 UTSW 2 121456550 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGACATTCTTCAGTGAGTCC -3'
(R):5'- CTGTTCTCCCTAGAGCAACC -3'

Sequencing Primer
(F):5'- ACATTCTTCAGTGAGTCCTGGGTG -3'
(R):5'- ACTCTGGCCTCCTACAAGC -3'
Posted On2018-11-06