Incidental Mutation 'R6909:Abca9'
ID538939
Institutional Source Beutler Lab
Gene Symbol Abca9
Ensembl Gene ENSMUSG00000041797
Gene NameATP-binding cassette, sub-family A (ABC1), member 9
SynonymsD630040K07Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_147220.2; MGI: 2386796

Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R6909 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location110100749-110168196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 110115497 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1261 (Q1261K)
Ref Sequence ENSEMBL: ENSMUSP00000036338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044850]
Predicted Effect probably benign
Transcript: ENSMUST00000044850
AA Change: Q1261K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000036338
Gene: ENSMUSG00000041797
AA Change: Q1261K

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 419 2.7e-31 PFAM
AAA 509 693 9.28e-12 SMART
low complexity region 817 837 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Pfam:ABC2_membrane_3 918 1219 5.2e-15 PFAM
low complexity region 1250 1259 N/A INTRINSIC
AAA 1317 1497 8.47e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two transmembrane domains and two nucleotide binding folds. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This gene is a member of the ABC1 subfamily and is clustered with four other ABC1 family members on chromosome 17q24. Transcriptional expression of this gene is induced during monocyte differentiation into macrophages and is suppressed by cholesterol import. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted(1

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp T C 9: 104,300,965 Y329C probably damaging Het
Agrn G T 4: 156,177,007 H585N possibly damaging Het
Ano1 G A 7: 144,655,731 T211M probably damaging Het
Atic T G 1: 71,576,846 probably null Het
Catsperd T A 17: 56,650,781 S229R probably damaging Het
Ccdc173 A T 2: 69,781,848 probably null Het
Cmya5 T C 13: 93,091,252 T2443A probably benign Het
Dysf A T 6: 84,192,938 E1772V probably damaging Het
Eps8l1 T A 7: 4,469,900 L107* probably null Het
Fam92a T C 4: 12,168,309 T97A probably benign Het
Fpr3 T A 17: 17,971,167 F233L probably benign Het
Gjc2 A T 11: 59,177,092 V188E unknown Het
Gm45861 T A 8: 27,527,081 Y690N unknown Het
Gm8251 C T 1: 44,059,775 R721Q possibly damaging Het
Gsdma2 T A 11: 98,652,557 C224* probably null Het
Gucy2d T A 7: 98,467,625 Y881N probably damaging Het
Hcn3 A G 3: 89,152,629 probably null Het
Hectd1 G T 12: 51,764,162 probably null Het
Ifitm5 A G 7: 140,949,259 F146L probably benign Het
Impg2 T C 16: 56,204,584 F18S probably damaging Het
Ino80c T A 18: 24,108,755 probably benign Het
Itga10 A G 3: 96,662,599 H1109R probably benign Het
Kdm3b T A 18: 34,827,328 probably null Het
Klra8 T G 6: 130,125,160 N104T probably benign Het
Llgl2 G A 11: 115,850,799 C585Y probably damaging Het
Lmod2 T A 6: 24,604,158 D377E probably benign Het
Lrat G A 3: 82,903,654 S20F probably damaging Het
Lrrc43 T A 5: 123,500,419 H363Q probably benign Het
Lyst T G 13: 13,743,375 I3340S probably damaging Het
Magi1 C A 6: 93,697,320 G948W probably damaging Het
Map3k4 A C 17: 12,270,985 F520V probably damaging Het
Mcm4 A T 16: 15,628,697 N607K probably damaging Het
Mta3 T C 17: 83,766,551 V216A possibly damaging Het
Ncor1 C A 11: 62,329,486 G2131V probably damaging Het
Olfr1123 A G 2: 87,418,615 H189R probably damaging Het
Olfr1155 A G 2: 87,942,690 S313P probably benign Het
Olfr373 T A 8: 72,100,528 V256E possibly damaging Het
Olfr827 T A 10: 130,210,753 I126L probably benign Het
Pramef8 T C 4: 143,417,909 L275P probably damaging Het
Ptpn2 A T 18: 67,675,971 probably null Het
Scn10a A G 9: 119,609,790 I1671T probably damaging Het
Scyl2 A T 10: 89,645,742 S622T probably benign Het
Sim1 C T 10: 50,909,410 R192C possibly damaging Het
Skor2 A G 18: 76,860,557 H658R possibly damaging Het
Slc10a5 A G 3: 10,335,595 S2P possibly damaging Het
Slc37a4 A T 9: 44,400,034 K207N possibly damaging Het
Syne2 G T 12: 76,064,195 V5768L probably benign Het
Tdpoz3 T A 3: 93,826,465 V149E probably damaging Het
Tekt5 T C 16: 10,358,301 N460S probably damaging Het
Tk2 G T 8: 104,236,810 Y142* probably null Het
Tkfc T A 19: 10,596,266 Q236L probably benign Het
Tln2 G A 9: 67,392,532 T148I probably damaging Het
Trim62 A G 4: 128,884,228 D20G probably damaging Het
Tspan14 A C 14: 40,913,441 V166G probably benign Het
Ttn A T 2: 76,881,721 probably benign Het
Vmn1r217 T A 13: 23,113,938 M265L probably benign Het
Vmn2r117 C G 17: 23,479,505 Q31H possibly damaging Het
Wdr66 A G 5: 123,287,752 Y418C probably damaging Het
Zfp72 T C 13: 74,371,742 T406A possibly damaging Het
Other mutations in Abca9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Abca9 APN 11 110160516 missense probably benign
IGL00467:Abca9 APN 11 110145670 splice site probably benign
IGL00886:Abca9 APN 11 110163275 missense possibly damaging 0.93
IGL01340:Abca9 APN 11 110130627 missense probably benign
IGL01351:Abca9 APN 11 110148903 missense probably damaging 0.99
IGL01383:Abca9 APN 11 110113293 splice site probably benign
IGL01384:Abca9 APN 11 110145637 missense probably damaging 1.00
IGL01482:Abca9 APN 11 110120773 missense probably benign 0.05
IGL01586:Abca9 APN 11 110154417 missense probably damaging 0.99
IGL01589:Abca9 APN 11 110155177 missense probably damaging 1.00
IGL01926:Abca9 APN 11 110135329 splice site probably benign
IGL02059:Abca9 APN 11 110160394 splice site probably benign
IGL02084:Abca9 APN 11 110130597 missense probably benign
IGL02096:Abca9 APN 11 110102533 missense probably damaging 1.00
IGL02096:Abca9 APN 11 110165980 missense probably benign 0.01
IGL02290:Abca9 APN 11 110135351 missense probably damaging 1.00
IGL02303:Abca9 APN 11 110154550 missense probably damaging 1.00
IGL02549:Abca9 APN 11 110102053 missense probably damaging 1.00
IGL02687:Abca9 APN 11 110114232 missense probably damaging 1.00
IGL02752:Abca9 APN 11 110127368 missense probably damaging 1.00
IGL02814:Abca9 APN 11 110154467 missense possibly damaging 0.90
IGL02878:Abca9 APN 11 110138329 missense probably benign 0.01
IGL03088:Abca9 APN 11 110144261 missense probably benign 0.06
IGL03231:Abca9 APN 11 110155268 missense probably damaging 0.96
R0050:Abca9 UTSW 11 110145591 missense probably damaging 1.00
R0050:Abca9 UTSW 11 110145591 missense probably damaging 1.00
R0064:Abca9 UTSW 11 110144871 missense probably damaging 1.00
R0064:Abca9 UTSW 11 110144872 missense probably damaging 1.00
R0068:Abca9 UTSW 11 110145579 missense probably damaging 0.99
R0189:Abca9 UTSW 11 110108653 missense probably damaging 1.00
R0189:Abca9 UTSW 11 110141662 splice site probably benign
R0375:Abca9 UTSW 11 110115447 missense probably benign 0.00
R0601:Abca9 UTSW 11 110117058 critical splice donor site probably null
R0624:Abca9 UTSW 11 110139620 missense probably damaging 1.00
R0652:Abca9 UTSW 11 110152063 missense probably benign 0.02
R1004:Abca9 UTSW 11 110151954 missense possibly damaging 0.88
R1222:Abca9 UTSW 11 110145064 splice site probably benign
R1451:Abca9 UTSW 11 110127447 missense probably damaging 1.00
R1462:Abca9 UTSW 11 110160516 missense probably benign
R1462:Abca9 UTSW 11 110160516 missense probably benign
R1474:Abca9 UTSW 11 110145579 missense probably damaging 0.99
R1499:Abca9 UTSW 11 110139632 missense probably benign 0.00
R1778:Abca9 UTSW 11 110130716 nonsense probably null
R2015:Abca9 UTSW 11 110131846 missense probably benign 0.01
R2295:Abca9 UTSW 11 110148903 missense probably damaging 0.99
R2303:Abca9 UTSW 11 110158226 missense probably benign 0.01
R2403:Abca9 UTSW 11 110115454 missense probably benign 0.16
R2886:Abca9 UTSW 11 110144886 splice site probably benign
R3435:Abca9 UTSW 11 110154430 missense probably benign 0.24
R3976:Abca9 UTSW 11 110148789 missense probably benign 0.25
R4335:Abca9 UTSW 11 110152017 missense probably damaging 1.00
R4411:Abca9 UTSW 11 110151955 missense probably benign 0.00
R4613:Abca9 UTSW 11 110144784 missense probably benign 0.26
R4690:Abca9 UTSW 11 110148880 missense probably damaging 1.00
R4720:Abca9 UTSW 11 110127422 missense probably damaging 1.00
R4751:Abca9 UTSW 11 110130570 missense probably benign 0.00
R4797:Abca9 UTSW 11 110118119 missense probably benign
R4818:Abca9 UTSW 11 110155154 critical splice donor site probably null
R4903:Abca9 UTSW 11 110147001 missense probably damaging 1.00
R4971:Abca9 UTSW 11 110152048 missense probably benign 0.43
R4977:Abca9 UTSW 11 110136073 missense probably benign 0.00
R5019:Abca9 UTSW 11 110165934 missense probably benign
R5079:Abca9 UTSW 11 110145569 missense possibly damaging 0.47
R5082:Abca9 UTSW 11 110131868 missense probably benign
R5093:Abca9 UTSW 11 110141532 missense probably damaging 0.98
R5212:Abca9 UTSW 11 110107226 missense probably benign 0.02
R5350:Abca9 UTSW 11 110115538 missense probably benign
R5368:Abca9 UTSW 11 110145546 missense probably damaging 1.00
R5432:Abca9 UTSW 11 110141554 missense possibly damaging 0.83
R5436:Abca9 UTSW 11 110134236 missense probably damaging 1.00
R5497:Abca9 UTSW 11 110130692 missense probably damaging 1.00
R5503:Abca9 UTSW 11 110141610 missense probably damaging 1.00
R5594:Abca9 UTSW 11 110144862 missense probably damaging 1.00
R5742:Abca9 UTSW 11 110160417 missense probably damaging 0.98
R5776:Abca9 UTSW 11 110107460 splice site probably null
R5781:Abca9 UTSW 11 110101987 missense probably damaging 1.00
R5872:Abca9 UTSW 11 110117076 missense possibly damaging 0.70
R5923:Abca9 UTSW 11 110160552 missense probably benign 0.09
R6020:Abca9 UTSW 11 110145613 missense possibly damaging 0.86
R6179:Abca9 UTSW 11 110134254 missense probably benign 0.05
R6245:Abca9 UTSW 11 110135423 missense probably damaging 1.00
R6249:Abca9 UTSW 11 110145627 missense probably benign
R6365:Abca9 UTSW 11 110145655 missense possibly damaging 0.63
R6385:Abca9 UTSW 11 110134254 missense probably damaging 0.99
R6481:Abca9 UTSW 11 110165962 nonsense probably null
R6675:Abca9 UTSW 11 110115476 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATCGTAGCTTGTGGACACTGC -3'
(R):5'- AAGTGAATAGCAGCATCGTTTGAC -3'

Sequencing Primer
(F):5'- GTAGCTTGTGGACACTGCATACC -3'
(R):5'- ATAGCAGCATCGTTTGACCAGTTG -3'
Posted On2018-11-06