Incidental Mutation 'R6910:Micu1'
ID538980
Institutional Source Beutler Lab
Gene Symbol Micu1
Ensembl Gene ENSMUSG00000020111
Gene Namemitochondrial calcium uptake 1
SynonymsC730016L05Rik, Cbara1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R6910 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location59702477-59864132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59740667 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 115 (E115G)
Ref Sequence ENSEMBL: ENSMUSP00000090166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020311] [ENSMUST00000092508] [ENSMUST00000165563] [ENSMUST00000167612] [ENSMUST00000171409] [ENSMUST00000179709]
Predicted Effect probably damaging
Transcript: ENSMUST00000020311
AA Change: E115G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020311
Gene: ENSMUSG00000020111
AA Change: E115G

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 230 258 8.16e-1 SMART
EFh 420 448 4.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092508
AA Change: E115G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090166
Gene: ENSMUSG00000020111
AA Change: E115G

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 228 256 8.16e-1 SMART
EFh 418 446 4.12e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165563
AA Change: E115G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126597
Gene: ENSMUSG00000020111
AA Change: E115G

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 224 252 8.16e-1 SMART
EFh 414 442 4.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167612
SMART Domains Protein: ENSMUSP00000126822
Gene: ENSMUSG00000020111

DomainStartEndE-ValueType
PDB:4NSD|B 1 35 2e-16 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000171409
AA Change: E82G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131000
Gene: ENSMUSG00000020111
AA Change: E82G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 56 61 N/A INTRINSIC
Pfam:EF-hand_6 191 221 1.8e-6 PFAM
Pfam:EF-hand_5 192 216 5.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179709
AA Change: E115G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136567
Gene: ENSMUSG00000020111
AA Change: E115G

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 224 252 8.16e-1 SMART
EFh 414 442 4.12e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential regulator of mitochondrial Ca2+ uptake under basal conditions. The encoded protein interacts with the mitochondrial calcium uniporter, a mitochondrial inner membrane Ca2+ channel, and is essential in preventing mitochondrial Ca2+ overload, which can cause excessive production of reactive oxygen species and cell stress. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,620,447 V151A probably damaging Het
Cfap54 A G 10: 92,836,512 S2899P probably benign Het
Chil5 A G 3: 106,019,661 W82R probably damaging Het
Dennd3 A G 15: 73,555,116 T781A probably benign Het
Epha2 A G 4: 141,321,513 D597G probably damaging Het
Gcn1l1 A G 5: 115,606,538 T1598A probably benign Het
Glp2r A G 11: 67,730,671 F162S probably benign Het
Gm10130 A T 2: 150,324,067 Q56L probably benign Het
Gm17655 T A 5: 110,047,173 R248* probably null Het
Gm9268 T C 7: 43,024,051 F178L probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Hapln2 A G 3: 88,023,828 Y127H probably damaging Het
Hdac4 G T 1: 91,982,153 T463K probably damaging Het
Ift80 A C 3: 68,927,735 S458A probably benign Het
Lama1 A G 17: 67,791,464 D1846G possibly damaging Het
Map3k8 A G 18: 4,340,801 I171T probably benign Het
Mrpl39 A G 16: 84,735,192 V9A unknown Het
Ncoa7 T G 10: 30,694,121 I281L possibly damaging Het
Nms A G 1: 38,941,895 E54G probably benign Het
Nrip1 G A 16: 76,294,417 A84V probably damaging Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr743 G A 14: 50,533,873 V154M probably benign Het
Pcdhga10 T A 18: 37,748,232 S349T probably damaging Het
R3hcc1 G A 14: 69,697,575 P454L probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr3 T C 2: 112,958,175 D170G probably damaging Het
Scp2 C A 4: 108,105,086 G81C probably damaging Het
Sez6 A G 11: 77,953,869 T173A possibly damaging Het
Syne1 T C 10: 5,048,887 H8142R probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tnfrsf11a A G 1: 105,844,546 T520A probably damaging Het
Tpm1 A G 9: 67,031,974 S170P probably damaging Het
Try5 T C 6: 41,311,799 D54G possibly damaging Het
Zan T C 5: 137,419,080 E3041G unknown Het
Zfp616 A T 11: 74,085,002 H699L probably damaging Het
Other mutations in Micu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Micu1 APN 10 59863278 missense possibly damaging 0.55
IGL02643:Micu1 APN 10 59839736 missense probably damaging 1.00
IGL03183:Micu1 APN 10 59728048 nonsense probably null
R0025:Micu1 UTSW 10 59788877 critical splice acceptor site probably null
R0645:Micu1 UTSW 10 59839681 missense possibly damaging 0.95
R0988:Micu1 UTSW 10 59756727 intron probably benign
R1121:Micu1 UTSW 10 59788982 missense possibly damaging 0.50
R1334:Micu1 UTSW 10 59788976 missense probably damaging 1.00
R1762:Micu1 UTSW 10 59863260 missense possibly damaging 0.70
R1925:Micu1 UTSW 10 59733161 splice site probably benign
R1976:Micu1 UTSW 10 59768213 missense probably damaging 1.00
R2082:Micu1 UTSW 10 59863307 missense probably benign 0.00
R2152:Micu1 UTSW 10 59863288 missense probably benign 0.01
R2395:Micu1 UTSW 10 59863202 nonsense probably null
R3619:Micu1 UTSW 10 59768258 splice site probably null
R3953:Micu1 UTSW 10 59750504 missense probably benign 0.01
R4809:Micu1 UTSW 10 59740822 missense probably benign
R4948:Micu1 UTSW 10 59863254 missense possibly damaging 0.56
R5103:Micu1 UTSW 10 59788984 missense possibly damaging 0.79
R5137:Micu1 UTSW 10 59827232 missense probably benign 0.20
R5431:Micu1 UTSW 10 59750521 missense possibly damaging 0.92
R5805:Micu1 UTSW 10 59827306 missense possibly damaging 0.46
R7030:Micu1 UTSW 10 59789021 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGGGTGTGAATGATATCTTGCAAG -3'
(R):5'- AGCAGTTGAAGCCATGACAG -3'

Sequencing Primer
(F):5'- CTCCAACTAGAGAGAGATAATG -3'
(R):5'- GCAGTTGAAGCCATGACAGTTATCC -3'
Posted On2018-11-06