Incidental Mutation 'R6910:Glp2r'
ID538984
Institutional Source Beutler Lab
Gene Symbol Glp2r
Ensembl Gene ENSMUSG00000049928
Gene Nameglucagon-like peptide 2 receptor
SynonymsGLP-2, 9530092J08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6910 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67661502-67771153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67730671 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 162 (F162S)
Ref Sequence ENSEMBL: ENSMUSP00000021289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021289] [ENSMUST00000051765]
Predicted Effect probably benign
Transcript: ENSMUST00000021289
AA Change: F162S

PolyPhen 2 Score 0.283 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021289
Gene: ENSMUSG00000049928
AA Change: F162S

DomainStartEndE-ValueType
Pfam:7tm_2 17 225 4.8e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051765
AA Change: F331S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000061560
Gene: ENSMUSG00000049928
AA Change: F331S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:HRM 53 122 3.4e-16 PFAM
Pfam:7tm_2 137 394 1.5e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor that is closely related to the glucagon receptor and binds to glucagon-like peptide-2 (GLP2). Signalling through GLP2 stimulates intestinal growth and increases villus height in the small intestine, concomitant with increased crypt cell proliferation and decreased enterocyte apoptosis. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null mutation display defects in Paneth cell physiology, increased small bowel bacterial loads, and increased susceptibility to small bowel injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,620,447 V151A probably damaging Het
Cfap54 A G 10: 92,836,512 S2899P probably benign Het
Chil5 A G 3: 106,019,661 W82R probably damaging Het
Dennd3 A G 15: 73,555,116 T781A probably benign Het
Epha2 A G 4: 141,321,513 D597G probably damaging Het
Gcn1l1 A G 5: 115,606,538 T1598A probably benign Het
Gm10130 A T 2: 150,324,067 Q56L probably benign Het
Gm17655 T A 5: 110,047,173 R248* probably null Het
Gm9268 T C 7: 43,024,051 F178L probably benign Het
Gnptab G A 10: 88,431,396 G450S probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Hapln2 A G 3: 88,023,828 Y127H probably damaging Het
Hdac4 G T 1: 91,982,153 T463K probably damaging Het
Ift80 A C 3: 68,927,735 S458A probably benign Het
Lama1 A G 17: 67,791,464 D1846G possibly damaging Het
Map3k8 A G 18: 4,340,801 I171T probably benign Het
Micu1 A G 10: 59,740,667 E115G probably damaging Het
Mrpl39 A G 16: 84,735,192 V9A unknown Het
Ncoa7 T G 10: 30,694,121 I281L possibly damaging Het
Nms A G 1: 38,941,895 E54G probably benign Het
Nrip1 G A 16: 76,294,417 A84V probably damaging Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr743 G A 14: 50,533,873 V154M probably benign Het
Pcdhga10 T A 18: 37,748,232 S349T probably damaging Het
R3hcc1 G A 14: 69,697,575 P454L probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Ryr3 T C 2: 112,958,175 D170G probably damaging Het
Scp2 C A 4: 108,105,086 G81C probably damaging Het
Sez6 A G 11: 77,953,869 T173A possibly damaging Het
Syne1 T C 10: 5,048,887 H8142R probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tnfrsf11a A G 1: 105,844,546 T520A probably damaging Het
Tpm1 A G 9: 67,031,974 S170P probably damaging Het
Try5 T C 6: 41,311,799 D54G possibly damaging Het
Zan T C 5: 137,419,080 E3041G unknown Het
Zfp616 A T 11: 74,085,002 H699L probably damaging Het
Other mutations in Glp2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Glp2r APN 11 67709644 missense probably benign
IGL02244:Glp2r APN 11 67721991 missense probably damaging 1.00
IGL02484:Glp2r APN 11 67740166 missense possibly damaging 0.90
R0013:Glp2r UTSW 11 67709712 missense possibly damaging 0.88
R0013:Glp2r UTSW 11 67709712 missense possibly damaging 0.88
R0195:Glp2r UTSW 11 67709708 missense probably damaging 0.99
R1612:Glp2r UTSW 11 67742207 missense possibly damaging 0.46
R1699:Glp2r UTSW 11 67757541 missense probably benign 0.09
R1944:Glp2r UTSW 11 67746792 missense probably benign 0.01
R3971:Glp2r UTSW 11 67746815 missense possibly damaging 0.65
R4417:Glp2r UTSW 11 67664516 intron probably benign
R4681:Glp2r UTSW 11 67730627 splice site probably null
R4914:Glp2r UTSW 11 67757593 nonsense probably null
R4918:Glp2r UTSW 11 67757593 nonsense probably null
R4938:Glp2r UTSW 11 67757593 nonsense probably null
R4940:Glp2r UTSW 11 67757593 nonsense probably null
R4941:Glp2r UTSW 11 67746703 splice site probably null
R4963:Glp2r UTSW 11 67757593 nonsense probably null
R4966:Glp2r UTSW 11 67757593 nonsense probably null
R5023:Glp2r UTSW 11 67741032 missense possibly damaging 0.82
R5121:Glp2r UTSW 11 67722100 splice site probably null
R5313:Glp2r UTSW 11 67757531 missense probably damaging 0.96
R5705:Glp2r UTSW 11 67709739 missense probably benign 0.30
R5790:Glp2r UTSW 11 67764799 missense probably damaging 1.00
R6074:Glp2r UTSW 11 67746814 missense unknown
R6595:Glp2r UTSW 11 67764777 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACACCTCTTCATAAGGGCCCTC -3'
(R):5'- GTCAACTTGCCTGTGGTTCC -3'

Sequencing Primer
(F):5'- AGACAGGTAGTTGAGCTCATTCC -3'
(R):5'- ACTTGCCTGTGGTTCCCATGG -3'
Posted On2018-11-06