Incidental Mutation 'R6912:Kif16b'
ID539064
Institutional Source Beutler Lab
Gene Symbol Kif16b
Ensembl Gene ENSMUSG00000038844
Gene Namekinesin family member 16B
Synonyms8430434E15Rik, N-3 kinesin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6912 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location142617474-142901531 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 142700099 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043589] [ENSMUST00000211861] [ENSMUST00000230763]
Predicted Effect probably benign
Transcript: ENSMUST00000043589
SMART Domains Protein: ENSMUSP00000042551
Gene: ENSMUSG00000038844

DomainStartEndE-ValueType
KISc 1 366 4.87e-173 SMART
FHA 477 529 1.43e-1 SMART
coiled coil region 597 809 N/A INTRINSIC
coiled coil region 835 858 N/A INTRINSIC
coiled coil region 941 1022 N/A INTRINSIC
PX 1179 1281 1.58e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211861
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000230763
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin-like protein that may be involved in intracellular trafficking. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Chimera embryos containing a knock-out allele and derived from tetraploid rescue exhibit lethal growth arrest at the blastocyst stage with abnormal development of the primitive endoderm, epiblast epithelium, and basement membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406B18Rik G A 7: 43,501,147 T67I possibly damaging Het
4931406P16Rik A G 7: 34,245,668 S384P probably benign Het
Abca5 A T 11: 110,306,280 M524K probably benign Het
Aco2 G A 15: 81,895,396 V134I probably benign Het
Acsf2 C T 11: 94,570,380 M323I probably benign Het
Acvr1 T C 2: 58,447,573 D499G probably benign Het
Armc5 G A 7: 128,240,425 C305Y probably damaging Het
Astl T C 2: 127,356,386 I286T probably benign Het
Atp8a2 G A 14: 60,012,410 S544L probably benign Het
Bbs7 G T 3: 36,605,704 A194E probably benign Het
Brca2 A G 5: 150,541,742 D1657G probably damaging Het
Cfap46 G A 7: 139,639,700 S1283L probably benign Het
Creld2 T C 15: 88,819,997 S64P probably damaging Het
Crtc1 T C 8: 70,398,311 E217G probably damaging Het
Cyp2d26 C T 15: 82,791,119 V345M probably benign Het
Cyp2j11 T C 4: 96,294,871 M487V probably benign Het
Dnah12 T C 14: 26,878,079 I3692T probably damaging Het
Dnah14 A T 1: 181,750,183 T3022S possibly damaging Het
Dtnb A T 12: 3,648,221 probably null Het
Erf T C 7: 25,244,578 T443A possibly damaging Het
Ermp1 T A 19: 29,616,611 I720F probably benign Het
Fam83b T A 9: 76,490,932 E963V probably damaging Het
Fat1 T A 8: 45,051,023 S4463T probably benign Het
Fbxw27 T A 9: 109,788,080 K118* probably null Het
Fcgbp A T 7: 28,089,704 Y565F probably benign Het
Gm128 A T 3: 95,240,429 S185T probably benign Het
Gm6309 C T 5: 146,168,830 E175K probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gprin2 T C 14: 34,194,640 Y391C probably damaging Het
Hexa T C 9: 59,539,938 L72P probably damaging Het
Hrasls5 A G 19: 7,639,465 probably benign Het
Il31ra T A 13: 112,549,464 D124V probably damaging Het
Kdm2a C T 19: 4,322,501 A939T probably benign Het
Kndc1 A T 7: 139,910,278 D232V probably damaging Het
Lrrc37a T G 11: 103,457,543 R2775S unknown Het
Luc7l3 C T 11: 94,309,636 R52H probably damaging Het
Mapk15 A T 15: 75,993,898 R13S probably damaging Het
Mdga2 G T 12: 66,506,115 Q187K probably benign Het
Mfsd2b G A 12: 4,870,611 Q69* probably null Het
Mlph A T 1: 90,945,620 D551V probably damaging Het
Mup5 A T 4: 61,834,569 F72L probably benign Het
Narf T C 11: 121,238,461 S24P probably benign Het
Ncapg2 A G 12: 116,426,582 I384V probably benign Het
Neo1 T C 9: 58,917,052 T698A probably benign Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Nrros T C 16: 32,162,239 R24G probably null Het
Olfr1331 T A 4: 118,869,138 M119K probably damaging Het
Olfr449 T C 6: 42,838,802 V307A probably benign Het
Pde9a T C 17: 31,466,412 S347P possibly damaging Het
Pitpnm3 T C 11: 72,070,396 D315G probably benign Het
Plekha6 C T 1: 133,272,535 A284V probably benign Het
Plekhg2 A G 7: 28,360,259 V1215A probably benign Het
Ppif C A 14: 25,698,287 A144E probably damaging Het
Ppp1r10 T C 17: 35,929,561 V581A possibly damaging Het
Prr12 A G 7: 45,048,845 probably benign Het
Rfx6 T C 10: 51,723,853 V565A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Saxo2 A G 7: 82,635,194 V152A possibly damaging Het
Sdk2 T C 11: 113,903,120 D86G probably benign Het
Shroom3 A T 5: 92,943,017 M1128L probably benign Het
Smok2a C A 17: 13,225,656 T40K probably benign Het
Tatdn1 C T 15: 58,921,269 probably null Het
Tbc1d2 C A 4: 46,649,712 G108V probably damaging Het
Tbck T C 3: 132,686,942 I48T possibly damaging Het
Tm7sf3 A G 6: 146,626,103 F75S possibly damaging Het
Tmx4 T C 2: 134,598,799 D245G probably benign Het
Trim68 A T 7: 102,684,468 D2E probably damaging Het
Trps1 T A 15: 50,822,298 Q157L possibly damaging Het
Ttc22 A G 4: 106,638,603 T385A probably benign Het
Ubap2l A T 3: 90,038,848 F150I possibly damaging Het
Ube2u C T 4: 100,532,155 R105W probably damaging Het
Ubr4 G A 4: 139,458,234 probably null Het
Unc5b A G 10: 60,831,092 L25P probably benign Het
Usp38 A G 8: 80,993,329 S424P probably damaging Het
Vmn1r222 T A 13: 23,232,204 S280C probably benign Het
Vmn1r59 A T 7: 5,454,600 F54I probably benign Het
Vmn2r-ps117 T A 17: 18,827,202 C536S probably damaging Het
Zkscan2 A C 7: 123,499,973 probably benign Het
Other mutations in Kif16b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kif16b APN 2 142848035 nonsense probably null
IGL00499:Kif16b APN 2 142857324 missense probably damaging 1.00
IGL00913:Kif16b APN 2 142704007 nonsense probably null
IGL00971:Kif16b APN 2 142711744 missense probably benign 0.01
IGL01712:Kif16b APN 2 142648471 missense probably damaging 1.00
IGL01965:Kif16b APN 2 142848405 missense probably damaging 1.00
IGL02428:Kif16b APN 2 142672360 missense possibly damaging 0.88
IGL02576:Kif16b APN 2 142862545 splice site probably benign
IGL02884:Kif16b APN 2 142702614 splice site probably benign
IGL03065:Kif16b APN 2 142619913 missense probably damaging 1.00
IGL03103:Kif16b APN 2 142862488 missense probably damaging 1.00
IGL03403:Kif16b APN 2 142711869 missense probably damaging 1.00
IGL02835:Kif16b UTSW 2 142712213 missense probably benign 0.00
R0058:Kif16b UTSW 2 142857305 splice site probably null
R0058:Kif16b UTSW 2 142857305 splice site probably null
R0081:Kif16b UTSW 2 142707426 splice site probably benign
R0123:Kif16b UTSW 2 142672375 missense probably benign
R0134:Kif16b UTSW 2 142672375 missense probably benign
R0388:Kif16b UTSW 2 142740937 missense probably damaging 1.00
R0396:Kif16b UTSW 2 142853659 missense probably damaging 1.00
R0502:Kif16b UTSW 2 142712155 missense probably benign 0.00
R1027:Kif16b UTSW 2 142854538 splice site probably benign
R1674:Kif16b UTSW 2 142712953 nonsense probably null
R1752:Kif16b UTSW 2 142690666 missense probably benign 0.01
R2154:Kif16b UTSW 2 142690580 missense probably damaging 1.00
R2262:Kif16b UTSW 2 142740917 missense probably damaging 1.00
R2401:Kif16b UTSW 2 142756122 missense probably benign 0.04
R3951:Kif16b UTSW 2 142707359 missense probably benign 0.01
R4161:Kif16b UTSW 2 142707404 missense probably benign 0.00
R4697:Kif16b UTSW 2 142690694 missense probably benign 0.09
R4747:Kif16b UTSW 2 142857426 missense probably damaging 1.00
R4808:Kif16b UTSW 2 142857358 missense probably damaging 1.00
R4878:Kif16b UTSW 2 142848003 missense probably damaging 1.00
R5068:Kif16b UTSW 2 142711707 missense probably benign
R5120:Kif16b UTSW 2 142848339 missense probably damaging 1.00
R5358:Kif16b UTSW 2 142740969 missense probably damaging 1.00
R5821:Kif16b UTSW 2 142702666 missense probably damaging 1.00
R5833:Kif16b UTSW 2 142707367 missense probably benign
R5882:Kif16b UTSW 2 142707258 critical splice donor site probably null
R5974:Kif16b UTSW 2 142857381 missense probably damaging 1.00
R6043:Kif16b UTSW 2 142711900 missense probably damaging 1.00
R6230:Kif16b UTSW 2 142849912 missense probably damaging 1.00
R6373:Kif16b UTSW 2 142699698 missense possibly damaging 0.91
R6472:Kif16b UTSW 2 142699948 intron probably benign
R6622:Kif16b UTSW 2 142712442 missense probably benign 0.01
R6654:Kif16b UTSW 2 142701277 intron probably benign
R7003:Kif16b UTSW 2 142758829 missense possibly damaging 0.95
R7265:Kif16b UTSW 2 142714730 missense probably damaging 1.00
R7307:Kif16b UTSW 2 142712931 missense probably benign 0.00
X0058:Kif16b UTSW 2 142758861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAGCAAGAGGTCCTCTGTGG -3'
(R):5'- TACAGATGCACCAAATTCCTGTC -3'

Sequencing Primer
(F):5'- TCTGTGGAGCCCAGGAAAC -3'
(R):5'- TCCGTCTTGACTATGAAGATGC -3'
Posted On2018-11-06