Incidental Mutation 'R6913:Frem2'
ID539151
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene NameFras1 related extracellular matrix protein 2
Synonymsmy, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6913 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location53513938-53657355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53516821 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 3065 (N3065S)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
Predicted Effect probably damaging
Transcript: ENSMUST00000091137
AA Change: N3065S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: N3065S

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 96.9%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A T 16: 20,378,744 I619N possibly damaging Het
Accsl T C 2: 93,866,143 K41E possibly damaging Het
Actr6 T C 10: 89,726,696 E107G probably damaging Het
Adam7 T A 14: 68,533,651 M9L probably benign Het
Adamts12 T A 15: 11,215,692 H266Q probably damaging Het
Adamts16 A G 13: 70,728,898 F1208S possibly damaging Het
Ankrd11 T C 8: 122,894,911 D734G probably benign Het
Ap1b1 T C 11: 5,012,972 V43A possibly damaging Het
Asnsd1 A G 1: 53,348,231 V79A probably damaging Het
Aste1 T A 9: 105,397,408 S221R probably benign Het
Ccndbp1 G A 2: 121,009,866 E94K probably benign Het
Cdc34 G A 10: 79,685,103 probably null Het
Cdh16 T C 8: 104,622,264 D67G probably benign Het
Chd8 T C 14: 52,214,494 E1348G probably damaging Het
Chl1 C T 6: 103,665,948 Q216* probably null Het
Cse1l G A 2: 166,929,877 V353I possibly damaging Het
Ctbp2 G A 7: 133,014,726 S160F possibly damaging Het
Cyp1a1 C A 9: 57,700,293 T68K probably damaging Het
Dlgap2 T A 8: 14,778,374 M594K probably benign Het
Dnah6 C T 6: 73,212,522 E48K probably benign Het
Dock2 A G 11: 34,756,222 V35A probably damaging Het
E330009J07Rik T C 6: 40,406,917 N397S possibly damaging Het
Edem2 A T 2: 155,726,674 S73R probably damaging Het
Eps15 T C 4: 109,361,230 V430A probably benign Het
Gal3st4 A T 5: 138,270,828 S123R possibly damaging Het
Garnl3 T A 2: 32,986,829 I937F possibly damaging Het
Gfod2 C T 8: 105,717,363 V183M possibly damaging Het
Glipr1l1 T C 10: 112,062,434 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gm7145 T G 1: 117,985,981 C198G probably damaging Het
Gm906 G T 13: 50,245,257 P1011H probably damaging Het
H2-Eb2 G A 17: 34,333,549 A123T possibly damaging Het
Ighv1-55 T C 12: 115,208,509 I7V probably benign Het
Itpripl2 G T 7: 118,491,109 P76T possibly damaging Het
Kat6a C A 8: 22,903,199 A231E possibly damaging Het
Lipo1 C T 19: 33,780,305 V255I probably benign Het
Mamstr A T 7: 45,643,238 M141L probably benign Het
Med13 A G 11: 86,319,876 V480A probably benign Het
Mei1 A G 15: 82,089,609 N523S probably benign Het
Mill2 A G 7: 18,856,426 T144A probably null Het
Muc16 C A 9: 18,642,663 L4111F unknown Het
Mylk2 G A 2: 152,913,690 G258E possibly damaging Het
Myom2 T G 8: 15,065,710 S42A probably benign Het
Nab1 C A 1: 52,464,836 G401C possibly damaging Het
Nifk T C 1: 118,332,862 V244A possibly damaging Het
Nipsnap2 C A 5: 129,753,293 Q224K probably benign Het
Nop16 T G 13: 54,589,740 K47Q probably damaging Het
Nup153 A T 13: 46,699,716 S548R probably damaging Het
Olfr1284 A G 2: 111,379,002 M1V probably null Het
Olfr1465 A G 19: 13,313,634 I217T probably benign Het
Olfr521 A C 7: 99,767,717 D185A probably damaging Het
Pard6g G A 18: 80,117,319 V216I possibly damaging Het
Pcdh20 C T 14: 88,468,602 V421I probably benign Het
Pcif1 G A 2: 164,884,304 probably null Het
Pde11a C A 2: 76,337,740 V290F probably damaging Het
Pisd T C 5: 32,737,429 Y511C probably damaging Het
Polg A T 7: 79,460,657 D276E probably damaging Het
Polr3b T C 10: 84,713,632 V906A probably damaging Het
Prkcg C T 7: 3,313,819 P270S probably benign Het
Rapgef2 T A 3: 79,085,974 I884F probably damaging Het
Rpl13 C A 8: 123,103,275 N113K possibly damaging Het
Rxra T A 2: 27,741,174 I139N probably damaging Het
Sf3b5 T A 10: 13,008,743 C41S probably benign Het
Stk24 C T 14: 121,302,809 R126Q probably damaging Het
Taar8b T C 10: 24,092,065 D77G possibly damaging Het
Tbc1d1 T A 5: 64,311,109 C566S probably benign Het
Tenm3 A T 8: 48,298,937 M948K probably damaging Het
Thbs4 T A 13: 92,757,936 Q693L possibly damaging Het
Tnfrsf26 A T 7: 143,618,389 C61* probably null Het
Trp63 A G 16: 25,889,168 E636G probably damaging Het
Try5 T C 6: 41,311,332 Y121C probably damaging Het
Ttn G T 2: 76,830,411 probably benign Het
Vamp1 T A 6: 125,218,945 V55D probably damaging Het
Vmn2r117 T C 17: 23,479,563 N12S probably damaging Het
Vmn2r90 G A 17: 17,704,061 G41S probably damaging Het
Zfp462 T A 4: 55,007,775 D71E probably benign Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53585595 missense probably damaging 1.00
IGL00911:Frem2 APN 3 53572462 missense probably damaging 1.00
IGL01322:Frem2 APN 3 53541038 missense probably benign 0.00
IGL01330:Frem2 APN 3 53655241 missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53525896 missense probably damaging 1.00
IGL01556:Frem2 APN 3 53535281 missense probably benign 0.23
IGL01580:Frem2 APN 3 53655175 missense probably damaging 1.00
IGL01606:Frem2 APN 3 53653591 missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53655709 missense probably benign 0.00
IGL01648:Frem2 APN 3 53535732 missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53517013 missense probably damaging 1.00
IGL01665:Frem2 APN 3 53549662 missense probably benign 0.07
IGL01670:Frem2 APN 3 53656937 missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53522304 missense probably benign 0.33
IGL02175:Frem2 APN 3 53655599 missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53519640 missense probably benign 0.35
IGL02202:Frem2 APN 3 53654799 missense probably benign 0.00
IGL02427:Frem2 APN 3 53535763 missense probably damaging 0.97
IGL02457:Frem2 APN 3 53521049 missense probably damaging 0.99
IGL02638:Frem2 APN 3 53551346 missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53652175 missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53655628 missense probably benign 0.40
IGL03169:Frem2 APN 3 53522292 missense probably benign 0.01
IGL03238:Frem2 APN 3 53656261 missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53572308 missense probably benign 0.01
IGL03273:Frem2 APN 3 53537509 nonsense probably null
IGL03343:Frem2 APN 3 53652253 missense probably damaging 1.00
Biosimilar UTSW 3 53654323 missense probably benign 0.01
Fruit_stripe UTSW 3 53537489 missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53653201 missense probably damaging 0.98
R0019:Frem2 UTSW 3 53523678 missense probably damaging 0.99
R0092:Frem2 UTSW 3 53589796 missense probably benign 0.03
R0108:Frem2 UTSW 3 53647961 missense probably benign 0.03
R0115:Frem2 UTSW 3 53656208 missense probably damaging 0.99
R0118:Frem2 UTSW 3 53535243 nonsense probably null
R0374:Frem2 UTSW 3 53653960 missense probably damaging 1.00
R0437:Frem2 UTSW 3 53653015 missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53519954 missense probably damaging 1.00
R0555:Frem2 UTSW 3 53516860 missense probably damaging 0.97
R0564:Frem2 UTSW 3 53656109 missense probably damaging 0.97
R0586:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R0726:Frem2 UTSW 3 53519626 missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53653973 missense probably benign
R1233:Frem2 UTSW 3 53547778 missense probably damaging 0.98
R1302:Frem2 UTSW 3 53655538 missense probably benign 0.00
R1333:Frem2 UTSW 3 53549731 missense probably benign 0.26
R1446:Frem2 UTSW 3 53654596 missense probably benign 0.31
R1523:Frem2 UTSW 3 53655407 missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53654210 missense probably benign 0.19
R1543:Frem2 UTSW 3 53572455 missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53654519 missense probably benign 0.19
R1600:Frem2 UTSW 3 53547723 missense probably damaging 1.00
R1678:Frem2 UTSW 3 53519938 missense probably damaging 1.00
R1687:Frem2 UTSW 3 53653952 missense probably benign
R1696:Frem2 UTSW 3 53656042 nonsense probably null
R1758:Frem2 UTSW 3 53653357 missense probably damaging 1.00
R1857:Frem2 UTSW 3 53654873 missense probably benign 0.10
R1869:Frem2 UTSW 3 53535196 missense probably benign 0.04
R1921:Frem2 UTSW 3 53653495 missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53652232 missense probably benign 0.01
R2045:Frem2 UTSW 3 53535744 missense probably damaging 1.00
R2113:Frem2 UTSW 3 53652922 missense probably damaging 1.00
R2152:Frem2 UTSW 3 53517029 nonsense probably null
R2164:Frem2 UTSW 3 53537330 missense probably damaging 1.00
R2181:Frem2 UTSW 3 53574587 missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53516573 missense probably benign
R2221:Frem2 UTSW 3 53516857 missense probably benign 0.00
R2255:Frem2 UTSW 3 53652514 missense probably damaging 0.96
R2280:Frem2 UTSW 3 53572423 missense probably damaging 1.00
R3196:Frem2 UTSW 3 53537331 missense probably damaging 1.00
R3716:Frem2 UTSW 3 53572360 missense probably damaging 1.00
R3807:Frem2 UTSW 3 53653449 missense probably benign 0.22
R3820:Frem2 UTSW 3 53516849 missense probably damaging 1.00
R3821:Frem2 UTSW 3 53652415 missense probably damaging 1.00
R3977:Frem2 UTSW 3 53652070 missense probably benign 0.00
R3979:Frem2 UTSW 3 53652070 missense probably benign 0.00
R4014:Frem2 UTSW 3 53652353 missense probably benign 0.01
R4127:Frem2 UTSW 3 53525896 missense probably damaging 1.00
R4195:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53545502 missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53539162 critical splice donor site probably null
R4428:Frem2 UTSW 3 53654338 missense probably benign 0.40
R4559:Frem2 UTSW 3 53654321 missense probably benign 0.01
R4600:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53655443 missense probably damaging 1.00
R4678:Frem2 UTSW 3 53544371 missense probably benign 0.00
R4689:Frem2 UTSW 3 53547635 missense probably benign 0.43
R4740:Frem2 UTSW 3 53535819 missense probably benign 0.04
R4748:Frem2 UTSW 3 53541093 missense probably damaging 1.00
R4790:Frem2 UTSW 3 53516741 missense probably benign
R4809:Frem2 UTSW 3 53653895 missense probably benign 0.01
R4930:Frem2 UTSW 3 53656315 missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53539183 missense probably damaging 1.00
R5057:Frem2 UTSW 3 53535196 missense probably benign 0.37
R5202:Frem2 UTSW 3 53551346 missense probably benign 0.41
R5221:Frem2 UTSW 3 53585611 missense probably damaging 1.00
R5231:Frem2 UTSW 3 53522295 missense probably damaging 1.00
R5268:Frem2 UTSW 3 53653154 missense probably damaging 0.96
R5480:Frem2 UTSW 3 53656507 nonsense probably null
R5637:Frem2 UTSW 3 53652937 missense probably damaging 0.97
R5664:Frem2 UTSW 3 53652490 missense probably benign 0.33
R5698:Frem2 UTSW 3 53652505 missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53655959 missense probably damaging 1.00
R5754:Frem2 UTSW 3 53537258 missense probably damaging 1.00
R5808:Frem2 UTSW 3 53652563 missense probably damaging 0.96
R5840:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R5874:Frem2 UTSW 3 53537489 missense probably benign 0.21
R6050:Frem2 UTSW 3 53653012 missense probably damaging 0.99
R6103:Frem2 UTSW 3 53549788 missense probably benign 0.00
R6149:Frem2 UTSW 3 53551341 missense probably damaging 0.98
R6182:Frem2 UTSW 3 53647969 missense probably damaging 1.00
R6191:Frem2 UTSW 3 53655280 missense probably benign 0.10
R6245:Frem2 UTSW 3 53655824 missense probably benign 0.00
R6252:Frem2 UTSW 3 53572448 missense probably damaging 1.00
R6393:Frem2 UTSW 3 53585640 missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53572378 missense probably benign 0.01
R6595:Frem2 UTSW 3 53549784 missense probably damaging 1.00
R6665:Frem2 UTSW 3 53654656 missense probably damaging 1.00
R6708:Frem2 UTSW 3 53585501 missense probably benign 0.00
R6751:Frem2 UTSW 3 53653665 missense probably damaging 1.00
R6787:Frem2 UTSW 3 53654323 missense probably benign 0.01
R6916:Frem2 UTSW 3 53547688 missense probably damaging 1.00
R7017:Frem2 UTSW 3 53519602 missense probably benign 0.02
R7083:Frem2 UTSW 3 53537493 missense probably damaging 0.99
R7108:Frem2 UTSW 3 53653513 missense probably damaging 1.00
R7133:Frem2 UTSW 3 53572339 missense possibly damaging 0.82
R7326:Frem2 UTSW 3 53654753 missense probably damaging 1.00
R7341:Frem2 UTSW 3 53654495 missense probably damaging 1.00
R7487:Frem2 UTSW 3 53654549 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GGAGTATCCTTGCCCTTAGTGC -3'
(R):5'- GCCGAGAGTGGTACATACAC -3'

Sequencing Primer
(F):5'- TGTTCCTGCACATGACGG -3'
(R):5'- GTGGTACATACACACAATCTATACGG -3'
Posted On2018-11-06