Incidental Mutation 'R6914:Prom2'
ID539215
Institutional Source Beutler Lab
Gene Symbol Prom2
Ensembl Gene ENSMUSG00000027376
Gene Nameprominin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6914 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location127526473-127541467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 127530375 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 723 (I723L)
Ref Sequence ENSEMBL: ENSMUSP00000028855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028855] [ENSMUST00000103214]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028855
AA Change: I723L

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028855
Gene: ENSMUSG00000027376
AA Change: I723L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Prominin 25 808 3.6e-279 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103214
AA Change: I723L

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099503
Gene: ENSMUSG00000027376
AA Change: I723L

DomainStartEndE-ValueType
Pfam:Prominin 18 818 3e-288 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prominin family of pentaspan membrane glycoproteins. The encoded protein localizes to basal epithelial cells and may be involved in the organization of plasma membrane microdomains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice exhibited signs of anemia, with decreased mean red blood cell count and decreased mean hemoglobin and hematocrit levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,011,297 K17* probably null Het
Abca6 T C 11: 110,190,238 I1183V probably benign Het
Adap2 A G 11: 80,155,065 D57G probably benign Het
Atmin G T 8: 116,956,713 V371F probably benign Het
C530008M17Rik A T 5: 76,857,007 Q405L unknown Het
Cacna1h G T 17: 25,385,039 A1273E probably benign Het
Cblb G A 16: 52,047,430 E134K probably damaging Het
Ccdc158 A G 5: 92,662,070 V193A probably benign Het
Cnot9 T A 1: 74,518,995 V100E probably damaging Het
Cog2 T A 8: 124,545,136 V463D probably benign Het
Crybg3 C T 16: 59,539,820 R2500H possibly damaging Het
Csmd3 C A 15: 48,011,138 R687S possibly damaging Het
Derl3 A G 10: 75,894,216 probably null Het
Dlc1 T C 8: 36,938,210 K142E probably benign Het
Dnaic1 T G 4: 41,625,176 M380R probably benign Het
Fam69c A C 18: 84,730,424 Y49S possibly damaging Het
Gas7 A T 11: 67,660,151 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpt C A 15: 76,697,592 Q138K probably benign Het
Greb1 T A 12: 16,707,902 E748V probably damaging Het
Hecw1 A C 13: 14,316,838 L523R probably damaging Het
Hhatl G A 9: 121,788,180 A329V probably benign Het
Homer3 C T 8: 70,291,551 T276I probably benign Het
Igdcc4 G A 9: 65,120,268 S204N probably benign Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Mccc2 C A 13: 99,990,350 D137Y probably damaging Het
Nupl2 T A 5: 24,181,084 S205T probably damaging Het
Pde8b T A 13: 95,086,844 M301L probably benign Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pom121 A T 5: 135,378,157 F1175I probably damaging Het
Pth1r C T 9: 110,728,016 probably null Het
Samd8 T C 14: 21,775,153 I59T possibly damaging Het
Scgb2b18 A G 7: 33,172,139 V85A possibly damaging Het
Sema6c G T 3: 95,173,208 V906L probably benign Het
Sipa1l3 T C 7: 29,386,091 T694A probably damaging Het
Slc26a2 A C 18: 61,199,279 I360S probably damaging Het
Slc8a1 A G 17: 81,408,120 L828P probably damaging Het
Spry1 T A 3: 37,643,044 D145E probably benign Het
Stat6 A T 10: 127,651,262 N213Y probably damaging Het
Tbx20 T C 9: 24,725,483 H436R probably benign Het
Tle2 T C 10: 81,586,356 Y411H probably damaging Het
Tmem45a T C 16: 56,825,782 N25S probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trrap T A 5: 144,784,043 I230N possibly damaging Het
Vezt A T 10: 93,970,451 H699Q probably benign Het
Vmn1r43 T A 6: 89,870,337 I56F probably benign Het
Other mutations in Prom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Prom2 APN 2 127541139 missense probably benign 0.04
IGL01140:Prom2 APN 2 127531205 splice site probably benign
IGL01300:Prom2 APN 2 127535089 missense probably benign 0.44
IGL01445:Prom2 APN 2 127539513 splice site probably benign
IGL01472:Prom2 APN 2 127532882 missense probably benign 0.39
IGL01541:Prom2 APN 2 127529130 critical splice donor site probably null
IGL01991:Prom2 APN 2 127529222 missense probably damaging 1.00
IGL02421:Prom2 APN 2 127531882 critical splice acceptor site probably null
IGL02557:Prom2 APN 2 127529471 missense possibly damaging 0.85
IGL02724:Prom2 APN 2 127538657 splice site probably benign
IGL02826:Prom2 APN 2 127531116 missense probably benign 0.07
IGL02830:Prom2 APN 2 127535069 missense possibly damaging 0.88
IGL02990:Prom2 APN 2 127528814 missense probably benign 0.10
R0110:Prom2 UTSW 2 127531113 missense possibly damaging 0.53
R0133:Prom2 UTSW 2 127538338 splice site probably benign
R0165:Prom2 UTSW 2 127539514 splice site probably benign
R0220:Prom2 UTSW 2 127541107 missense probably benign 0.03
R0466:Prom2 UTSW 2 127528789 missense probably damaging 0.99
R0505:Prom2 UTSW 2 127532867 missense possibly damaging 0.82
R0605:Prom2 UTSW 2 127539995 critical splice donor site probably null
R0633:Prom2 UTSW 2 127539525 missense probably benign 0.19
R0947:Prom2 UTSW 2 127538263 missense possibly damaging 0.69
R1682:Prom2 UTSW 2 127540162 missense possibly damaging 0.90
R1806:Prom2 UTSW 2 127532882 missense probably damaging 1.00
R1859:Prom2 UTSW 2 127541097 missense probably damaging 0.97
R1864:Prom2 UTSW 2 127539787 missense probably benign 0.00
R1866:Prom2 UTSW 2 127536594 missense probably damaging 0.99
R3824:Prom2 UTSW 2 127535673 splice site probably benign
R4472:Prom2 UTSW 2 127540191 missense probably benign 0.06
R5078:Prom2 UTSW 2 127531837 missense probably benign 0.00
R5889:Prom2 UTSW 2 127529411 missense possibly damaging 0.79
R5930:Prom2 UTSW 2 127530133 nonsense probably null
R6214:Prom2 UTSW 2 127539775 critical splice donor site probably null
R6215:Prom2 UTSW 2 127539775 critical splice donor site probably null
R7099:Prom2 UTSW 2 127539778 missense probably benign
R7427:Prom2 UTSW 2 127539811 missense probably damaging 0.99
R7428:Prom2 UTSW 2 127539811 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAAACACTCAGTGGCCTG -3'
(R):5'- AAGGATCCCTTTCTTAGGCCTC -3'

Sequencing Primer
(F):5'- ACTCAGTGGCCTGCAGGAAG -3'
(R):5'- TAGGCCTCTTGGTCCTAGAGC -3'
Posted On2018-11-06