Incidental Mutation 'R6914:Derl3'
ID539236
Institutional Source Beutler Lab
Gene Symbol Derl3
Ensembl Gene ENSMUSG00000009092
Gene NameDer1-like domain family, member 3
Synonyms1810063P04Rik, 1810006I20Rik, IZP6, derlin-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6914 (G1)
Quality Score151.008
Status Not validated
Chromosome10
Chromosomal Location75893413-75895941 bp(+) (GRCm38)
Type of Mutationintron (156 bp from exon)
DNA Base Change (assembly) A to G at 75894216 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000925] [ENSMUST00000009236] [ENSMUST00000121304] [ENSMUST00000140388] [ENSMUST00000217811]
Predicted Effect probably benign
Transcript: ENSMUST00000000925
SMART Domains Protein: ENSMUSP00000000925
Gene: ENSMUSG00000000902

DomainStartEndE-ValueType
Blast:HX 31 52 9e-8 BLAST
Pfam:SNF5 179 254 1.1e-27 PFAM
Pfam:SNF5 249 373 3.1e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000009236
SMART Domains Protein: ENSMUSP00000009236
Gene: ENSMUSG00000009092

DomainStartEndE-ValueType
Pfam:DER1 13 203 7.4e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121304
SMART Domains Protein: ENSMUSP00000112463
Gene: ENSMUSG00000000902

DomainStartEndE-ValueType
Blast:HX 31 52 9e-8 BLAST
Pfam:SNF5 169 364 1.7e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140388
Predicted Effect probably null
Transcript: ENSMUST00000217811
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in the degradation of misfolded glycoproteins in the ER. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for this gene trapped allele show no obvious phenotype alterations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T A 12: 17,011,297 K17* probably null Het
Abca6 T C 11: 110,190,238 I1183V probably benign Het
Adap2 A G 11: 80,155,065 D57G probably benign Het
Atmin G T 8: 116,956,713 V371F probably benign Het
C530008M17Rik A T 5: 76,857,007 Q405L unknown Het
Cacna1h G T 17: 25,385,039 A1273E probably benign Het
Cblb G A 16: 52,047,430 E134K probably damaging Het
Ccdc158 A G 5: 92,662,070 V193A probably benign Het
Cnot9 T A 1: 74,518,995 V100E probably damaging Het
Cog2 T A 8: 124,545,136 V463D probably benign Het
Crybg3 C T 16: 59,539,820 R2500H possibly damaging Het
Csmd3 C A 15: 48,011,138 R687S possibly damaging Het
Dlc1 T C 8: 36,938,210 K142E probably benign Het
Dnaic1 T G 4: 41,625,176 M380R probably benign Het
Fam69c A C 18: 84,730,424 Y49S possibly damaging Het
Gas7 A T 11: 67,660,151 probably null Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpt C A 15: 76,697,592 Q138K probably benign Het
Greb1 T A 12: 16,707,902 E748V probably damaging Het
Hecw1 A C 13: 14,316,838 L523R probably damaging Het
Hhatl G A 9: 121,788,180 A329V probably benign Het
Homer3 C T 8: 70,291,551 T276I probably benign Het
Igdcc4 G A 9: 65,120,268 S204N probably benign Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Mccc2 C A 13: 99,990,350 D137Y probably damaging Het
Nupl2 T A 5: 24,181,084 S205T probably damaging Het
Pde8b T A 13: 95,086,844 M301L probably benign Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pom121 A T 5: 135,378,157 F1175I probably damaging Het
Prom2 T G 2: 127,530,375 I723L possibly damaging Het
Pth1r C T 9: 110,728,016 probably null Het
Samd8 T C 14: 21,775,153 I59T possibly damaging Het
Scgb2b18 A G 7: 33,172,139 V85A possibly damaging Het
Sema6c G T 3: 95,173,208 V906L probably benign Het
Sipa1l3 T C 7: 29,386,091 T694A probably damaging Het
Slc26a2 A C 18: 61,199,279 I360S probably damaging Het
Slc8a1 A G 17: 81,408,120 L828P probably damaging Het
Spry1 T A 3: 37,643,044 D145E probably benign Het
Stat6 A T 10: 127,651,262 N213Y probably damaging Het
Tbx20 T C 9: 24,725,483 H436R probably benign Het
Tle2 T C 10: 81,586,356 Y411H probably damaging Het
Tmem45a T C 16: 56,825,782 N25S probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trrap T A 5: 144,784,043 I230N possibly damaging Het
Vezt A T 10: 93,970,451 H699Q probably benign Het
Vmn1r43 T A 6: 89,870,337 I56F probably benign Het
Other mutations in Derl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02735:Derl3 APN 10 75895116 missense probably damaging 0.97
IGL03143:Derl3 APN 10 75894490 missense possibly damaging 0.90
R0730:Derl3 UTSW 10 75895242 splice site probably benign
R4819:Derl3 UTSW 10 75893879 intron probably null
R5524:Derl3 UTSW 10 75894490 missense possibly damaging 0.90
R6041:Derl3 UTSW 10 75893501 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGCTGACTTCGTTTTCATG -3'
(R):5'- AAGAGTCAAGGCTTCCTGGAG -3'

Sequencing Primer
(F):5'- AGGCTGACTTCGTTTTCATGTTTCTC -3'
(R):5'- TCAAGGCTTCCTGGAGCAGTC -3'
Posted On2018-11-06