Incidental Mutation 'R6915:Vps39'
ID539264
Institutional Source Beutler Lab
Gene Symbol Vps39
Ensembl Gene ENSMUSG00000027291
Gene NameVPS39 HOPS complex subunit
SynonymsmVam6, Vam6P, Vam6, A230065P22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R6915 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location120316461-120353137 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 120321031 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 738 (Y738*)
Ref Sequence ENSEMBL: ENSMUSP00000099559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028752] [ENSMUST00000102501]
Predicted Effect probably null
Transcript: ENSMUST00000028752
AA Change: Y727*
SMART Domains Protein: ENSMUSP00000028752
Gene: ENSMUSG00000027291
AA Change: Y727*

DomainStartEndE-ValueType
Pfam:CNH 19 280 8.3e-53 PFAM
Pfam:Clathrin 410 536 3.9e-9 PFAM
Pfam:Vps39_1 449 551 1.7e-35 PFAM
Pfam:Clathrin 570 740 2.3e-8 PFAM
Pfam:Vps39_2 761 869 5.1e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102501
AA Change: Y738*
SMART Domains Protein: ENSMUSP00000099559
Gene: ENSMUSG00000027291
AA Change: Y738*

DomainStartEndE-ValueType
Pfam:CNH 20 291 1.3e-32 PFAM
Pfam:Clathrin 421 547 2e-9 PFAM
Pfam:Vps39_1 460 562 6.7e-36 PFAM
Pfam:Clathrin 582 751 2.3e-8 PFAM
Pfam:Vps39_2 772 880 6.6e-36 PFAM
Meta Mutation Damage Score 0.628 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may promote clustering and fusion of late endosomes and lysosomes. The protein may also act as an adaptor protein that modulates the transforming growth factor-beta response by coupling the transforming growth factor-beta receptor complex to the Smad pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,455,620 L334I probably damaging Het
Akap9 T A 5: 3,960,551 M436K probably benign Het
Ankmy1 A C 1: 92,888,451 F314V probably null Het
Arid5b G A 10: 68,186,212 Q183* probably null Het
Atp8b4 A T 2: 126,358,914 L778* probably null Het
BC024139 G T 15: 76,120,021 N739K probably benign Het
Carns1 T G 19: 4,169,913 H441P probably benign Het
Cfap70 T A 14: 20,409,085 I693F probably benign Het
Cldn3 A G 5: 134,986,572 Q43R probably damaging Het
Col7a1 C T 9: 108,967,618 P1608L probably benign Het
Cr2 T A 1: 195,171,146 Y28F probably benign Het
Cyp2c38 T A 19: 39,436,068 I269F probably damaging Het
Dapk1 A T 13: 60,696,442 I92F probably damaging Het
Dennd4a T A 9: 64,852,489 L292* probably null Het
Dhx38 T C 8: 109,559,599 E353G probably benign Het
Dnm3 T C 1: 162,318,397 probably null Het
Dzip3 T C 16: 48,942,125 I794V possibly damaging Het
Eif2b5 T A 16: 20,502,750 V351D possibly damaging Het
Epg5 T A 18: 77,979,165 V1041E probably benign Het
Exoc4 A G 6: 33,921,453 K869R possibly damaging Het
Fat3 C A 9: 16,377,748 V160F probably benign Het
Gak A T 5: 108,602,950 Y365N probably benign Het
Ghrhr T A 6: 55,383,119 probably null Het
Gm21738 A G 14: 19,415,933 M202T probably benign Het
Gm6583 A T 5: 112,354,657 W394R probably damaging Het
Havcr2 C T 11: 46,475,911 S177L probably benign Het
Hkdc1 G C 10: 62,401,932 R353G possibly damaging Het
Ifi208 G A 1: 173,682,878 G200S probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lair1 A T 7: 4,055,953 V12E possibly damaging Het
Lipo3 T C 19: 33,584,893 N26D probably damaging Het
Lyst T A 13: 13,726,044 D3168E probably benign Het
Map6 G A 7: 99,268,247 A76T probably damaging Het
Mcoln3 A T 3: 146,137,256 probably null Het
Muc4 T C 16: 32,766,938 F2718L probably benign Het
Nek11 C G 9: 105,393,057 probably benign Het
Olfr1428 A G 19: 12,109,126 V140A probably benign Het
Olfr372 C A 8: 72,057,730 L17I probably benign Het
Olfr964-ps1 T C 9: 39,686,536 E136G unknown Het
Pcdh15 A T 10: 74,643,809 E846V probably benign Het
Pcdhga8 C T 18: 37,725,945 T18M probably benign Het
Per3 T C 4: 151,043,649 M61V possibly damaging Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pitpnm1 A G 19: 4,106,947 Y490C possibly damaging Het
Plcb4 A T 2: 135,947,115 I272F possibly damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prkce G C 17: 86,493,407 G417A probably damaging Het
Ptar1 A G 19: 23,703,137 N106D probably damaging Het
Rbm15 C A 3: 107,332,311 R257L probably benign Het
Rptor T G 11: 119,756,345 M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 W350R probably damaging Het
Ryr2 T G 13: 11,745,601 Y1532S probably damaging Het
Serpina1a C A 12: 103,853,851 V379L possibly damaging Het
Sox8 C T 17: 25,567,914 V272I probably damaging Het
Spert T A 14: 75,592,658 T32S probably benign Het
Stard9 C T 2: 120,702,630 H3123Y probably benign Het
Taar9 C T 10: 24,109,012 E175K possibly damaging Het
Tinag T A 9: 77,001,615 Y348F probably damaging Het
Tktl2 T C 8: 66,513,035 I415T probably damaging Het
Tm7sf2 G T 19: 6,068,312 R718S probably damaging Het
Tmem229a G T 6: 24,954,658 Q366K probably benign Het
Txndc2 T C 17: 65,638,291 D297G probably benign Het
Ulk4 A G 9: 121,258,820 F269L probably benign Het
Other mutations in Vps39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Vps39 APN 2 120350238 splice site probably benign
IGL01629:Vps39 APN 2 120323598 missense probably benign 0.11
IGL01812:Vps39 APN 2 120320790 splice site probably benign
IGL01936:Vps39 APN 2 120323128 missense probably benign 0.23
IGL02379:Vps39 APN 2 120323608 missense probably benign 0.17
IGL02892:Vps39 APN 2 120323171 splice site probably benign
IGL02943:Vps39 APN 2 120339487 missense possibly damaging 0.77
R0001:Vps39 UTSW 2 120318053 missense probably benign 0.09
R0329:Vps39 UTSW 2 120338787 missense possibly damaging 0.89
R0330:Vps39 UTSW 2 120338787 missense possibly damaging 0.89
R0364:Vps39 UTSW 2 120345638 missense probably damaging 1.00
R1483:Vps39 UTSW 2 120323648 missense probably damaging 1.00
R1625:Vps39 UTSW 2 120323625 missense probably damaging 1.00
R1837:Vps39 UTSW 2 120325397 missense probably damaging 1.00
R1839:Vps39 UTSW 2 120325397 missense probably damaging 1.00
R1934:Vps39 UTSW 2 120318077 missense probably damaging 1.00
R2018:Vps39 UTSW 2 120343227 missense probably damaging 1.00
R2019:Vps39 UTSW 2 120343227 missense probably damaging 1.00
R2178:Vps39 UTSW 2 120323679 nonsense probably null
R2513:Vps39 UTSW 2 120338787 missense probably damaging 1.00
R3771:Vps39 UTSW 2 120342016 missense possibly damaging 0.85
R3952:Vps39 UTSW 2 120350175 missense probably benign 0.15
R4580:Vps39 UTSW 2 120339333 missense probably benign 0.35
R4815:Vps39 UTSW 2 120338559 missense probably benign 0.37
R4851:Vps39 UTSW 2 120321831 intron probably benign
R4894:Vps39 UTSW 2 120352959 missense probably damaging 1.00
R5447:Vps39 UTSW 2 120352932 missense probably benign 0.43
R5483:Vps39 UTSW 2 120323083 missense probably benign 0.08
R5715:Vps39 UTSW 2 120325236 missense possibly damaging 0.73
R5886:Vps39 UTSW 2 120321572 intron probably benign
R5949:Vps39 UTSW 2 120328668 missense probably benign 0.23
R5954:Vps39 UTSW 2 120324662 missense probably damaging 1.00
R5973:Vps39 UTSW 2 120328705 missense probably damaging 0.99
R6004:Vps39 UTSW 2 120345650 missense possibly damaging 0.89
R6208:Vps39 UTSW 2 120333416 missense probably damaging 0.98
R6705:Vps39 UTSW 2 120320676 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAAAGCTCTTGCCTGCCC -3'
(R):5'- AGAAAGAGCAGTATTGGTGTCC -3'

Sequencing Primer
(F):5'- CCCAGCCAGCCCTGTCC -3'
(R):5'- GGCTGCTTGATTTTGCCAAAAAG -3'
Posted On2018-11-06