Incidental Mutation 'R6915:Runx1t1'
ID539270
Institutional Source Beutler Lab
Gene Symbol Runx1t1
Ensembl Gene ENSMUSG00000006586
Gene Namerunt-related transcription factor 1; translocated to, 1 (cyclin D-related)
SynonymsCbfa2t1h, ETO, MTG8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.802) question?
Stock #R6915 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location13743436-13893649 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13865257 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 350 (W350R)
Ref Sequence ENSEMBL: ENSMUSP00000127109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006761] [ENSMUST00000098256] [ENSMUST00000098257] [ENSMUST00000105566]
Predicted Effect probably damaging
Transcript: ENSMUST00000006761
AA Change: W330R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000006761
Gene: ENSMUSG00000006586
AA Change: W330R

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 68 96 N/A INTRINSIC
TAFH 102 192 1.12e-53 SMART
low complexity region 266 277 N/A INTRINSIC
Pfam:NHR2 317 383 6.9e-42 PFAM
SCOP:d1gpua1 384 454 7e-3 SMART
PDB:2KYG|C 417 447 2e-12 PDB
Pfam:zf-MYND 495 531 4e-10 PFAM
low complexity region 543 558 N/A INTRINSIC
low complexity region 562 583 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098256
AA Change: W323R

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095856
Gene: ENSMUSG00000006586
AA Change: W323R

DomainStartEndE-ValueType
low complexity region 25 41 N/A INTRINSIC
low complexity region 61 89 N/A INTRINSIC
TAFH 95 185 1.12e-53 SMART
low complexity region 259 270 N/A INTRINSIC
Pfam:NHR2 310 376 7.3e-42 PFAM
SCOP:d1gpua1 377 447 7e-3 SMART
PDB:2KYG|C 410 440 2e-12 PDB
Pfam:zf-MYND 488 524 2.5e-10 PFAM
low complexity region 536 551 N/A INTRINSIC
low complexity region 555 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098257
AA Change: W350R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095857
Gene: ENSMUSG00000006586
AA Change: W350R

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
TAFH 122 212 1.12e-53 SMART
low complexity region 286 297 N/A INTRINSIC
Pfam:NHR2 337 403 5.2e-43 PFAM
SCOP:d1gpua1 404 474 7e-3 SMART
PDB:2KYG|C 437 467 2e-12 PDB
Pfam:zf-MYND 515 551 6.7e-10 PFAM
low complexity region 563 578 N/A INTRINSIC
low complexity region 582 603 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105566
AA Change: W350R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127109
Gene: ENSMUSG00000006586
AA Change: W350R

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
TAFH 122 212 1.12e-53 SMART
low complexity region 286 297 N/A INTRINSIC
Pfam:NHR2 337 403 3.6e-42 PFAM
SCOP:d1gpua1 404 474 7e-3 SMART
PDB:2KYG|C 437 467 2e-12 PDB
Pfam:zf-MYND 515 551 1.4e-10 PFAM
low complexity region 563 578 N/A INTRINSIC
low complexity region 582 603 N/A INTRINSIC
Meta Mutation Damage Score 0.234 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myeloid translocation gene family which interact with DNA-bound transcription factors and recruit a range of corepressors to facilitate transcriptional repression. The t(8;21)(q22;q22) translocation is one of the most frequent karyotypic abnormalities in acute myeloid leukemia. The translocation produces a chimeric gene made up of the 5'-region of the runt-related transcription factor 1 gene fused to the 3'-region of this gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous disruption of this gene results in increased perinatal lethality and surviving animals show severe growth retardation. The midgut is absent in 25% of mutant animals which could explain increased perinatal mortality. Surviving animals display thinned intestinal walls and dilated lumens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,455,620 L334I probably damaging Het
Akap9 T A 5: 3,960,551 M436K probably benign Het
Ankmy1 A C 1: 92,888,451 F314V probably null Het
Arid5b G A 10: 68,186,212 Q183* probably null Het
Atp8b4 A T 2: 126,358,914 L778* probably null Het
BC024139 G T 15: 76,120,021 N739K probably benign Het
Carns1 T G 19: 4,169,913 H441P probably benign Het
Cfap70 T A 14: 20,409,085 I693F probably benign Het
Cldn3 A G 5: 134,986,572 Q43R probably damaging Het
Col7a1 C T 9: 108,967,618 P1608L probably benign Het
Cr2 T A 1: 195,171,146 Y28F probably benign Het
Cyp2c38 T A 19: 39,436,068 I269F probably damaging Het
Dapk1 A T 13: 60,696,442 I92F probably damaging Het
Dennd4a T A 9: 64,852,489 L292* probably null Het
Dhx38 T C 8: 109,559,599 E353G probably benign Het
Dnm3 T C 1: 162,318,397 probably null Het
Dzip3 T C 16: 48,942,125 I794V possibly damaging Het
Eif2b5 T A 16: 20,502,750 V351D possibly damaging Het
Epg5 T A 18: 77,979,165 V1041E probably benign Het
Exoc4 A G 6: 33,921,453 K869R possibly damaging Het
Fat3 C A 9: 16,377,748 V160F probably benign Het
Gak A T 5: 108,602,950 Y365N probably benign Het
Ghrhr T A 6: 55,383,119 probably null Het
Gm21738 A G 14: 19,415,933 M202T probably benign Het
Gm6583 A T 5: 112,354,657 W394R probably damaging Het
Havcr2 C T 11: 46,475,911 S177L probably benign Het
Hkdc1 G C 10: 62,401,932 R353G possibly damaging Het
Ifi208 G A 1: 173,682,878 G200S probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lair1 A T 7: 4,055,953 V12E possibly damaging Het
Lipo3 T C 19: 33,584,893 N26D probably damaging Het
Lyst T A 13: 13,726,044 D3168E probably benign Het
Map6 G A 7: 99,268,247 A76T probably damaging Het
Mcoln3 A T 3: 146,137,256 probably null Het
Muc4 T C 16: 32,766,938 F2718L probably benign Het
Nek11 C G 9: 105,393,057 probably benign Het
Olfr1428 A G 19: 12,109,126 V140A probably benign Het
Olfr372 C A 8: 72,057,730 L17I probably benign Het
Olfr964-ps1 T C 9: 39,686,536 E136G unknown Het
Pcdh15 A T 10: 74,643,809 E846V probably benign Het
Pcdhga8 C T 18: 37,725,945 T18M probably benign Het
Per3 T C 4: 151,043,649 M61V possibly damaging Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pitpnm1 A G 19: 4,106,947 Y490C possibly damaging Het
Plcb4 A T 2: 135,947,115 I272F possibly damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prkce G C 17: 86,493,407 G417A probably damaging Het
Ptar1 A G 19: 23,703,137 N106D probably damaging Het
Rbm15 C A 3: 107,332,311 R257L probably benign Het
Rptor T G 11: 119,756,345 M254R probably damaging Het
Ryr2 T G 13: 11,745,601 Y1532S probably damaging Het
Serpina1a C A 12: 103,853,851 V379L possibly damaging Het
Sox8 C T 17: 25,567,914 V272I probably damaging Het
Spert T A 14: 75,592,658 T32S probably benign Het
Stard9 C T 2: 120,702,630 H3123Y probably benign Het
Taar9 C T 10: 24,109,012 E175K possibly damaging Het
Tinag T A 9: 77,001,615 Y348F probably damaging Het
Tktl2 T C 8: 66,513,035 I415T probably damaging Het
Tm7sf2 G T 19: 6,068,312 R718S probably damaging Het
Tmem229a G T 6: 24,954,658 Q366K probably benign Het
Txndc2 T C 17: 65,638,291 D297G probably benign Het
Ulk4 A G 9: 121,258,820 F269L probably benign Het
Vps39 A T 2: 120,321,031 Y738* probably null Het
Other mutations in Runx1t1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Runx1t1 APN 4 13835663 missense probably benign 0.07
IGL01600:Runx1t1 APN 4 13841871 missense probably damaging 1.00
IGL02120:Runx1t1 APN 4 13846884 missense probably benign
IGL02172:Runx1t1 APN 4 13859924 missense probably benign 0.00
IGL02429:Runx1t1 APN 4 13865294 splice site probably benign
IGL02730:Runx1t1 APN 4 13860019 missense probably benign 0.01
IGL02870:Runx1t1 APN 4 13889867 missense unknown
IGL02879:Runx1t1 APN 4 13889868 missense unknown
IGL03369:Runx1t1 APN 4 13881107 missense probably damaging 1.00
IGL03047:Runx1t1 UTSW 4 13865882 missense probably damaging 1.00
R1832:Runx1t1 UTSW 4 13835628 splice site probably benign
R1884:Runx1t1 UTSW 4 13835767 missense probably benign 0.00
R2277:Runx1t1 UTSW 4 13771501 missense probably benign 0.00
R4059:Runx1t1 UTSW 4 13889769 missense probably benign 0.33
R4505:Runx1t1 UTSW 4 13889676 missense probably damaging 1.00
R4585:Runx1t1 UTSW 4 13889864 missense unknown
R4586:Runx1t1 UTSW 4 13889864 missense unknown
R4758:Runx1t1 UTSW 4 13865907 missense probably damaging 1.00
R4795:Runx1t1 UTSW 4 13837767 missense probably damaging 0.99
R4796:Runx1t1 UTSW 4 13837767 missense probably damaging 0.99
R4897:Runx1t1 UTSW 4 13771459 start codon destroyed probably null 0.01
R4971:Runx1t1 UTSW 4 13837978 missense probably damaging 1.00
R5009:Runx1t1 UTSW 4 13865231 missense possibly damaging 0.80
R5091:Runx1t1 UTSW 4 13846830 nonsense probably null
R5844:Runx1t1 UTSW 4 13881068 missense probably damaging 1.00
R5968:Runx1t1 UTSW 4 13841890 splice site probably null
R5993:Runx1t1 UTSW 4 13841863 missense probably damaging 0.98
R5993:Runx1t1 UTSW 4 13875490 missense probably benign 0.00
R6329:Runx1t1 UTSW 4 13785136 start codon destroyed probably null 0.38
R7283:Runx1t1 UTSW 4 13846935 missense probably damaging 1.00
Z1088:Runx1t1 UTSW 4 13865892 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GAAGGCACCTACCAGAGTCATTATG -3'
(R):5'- AAGACAGTGGCCTGCTGATC -3'

Sequencing Primer
(F):5'- AGAGTCATTATGTGTTCACATCCCG -3'
(R):5'- GCTGATCTGCCTTCTCCCAAG -3'
Posted On2018-11-06