Incidental Mutation 'R6915:Adck1'
ID539298
Institutional Source Beutler Lab
Gene Symbol Adck1
Ensembl Gene ENSMUSG00000021044
Gene NameaarF domain containing kinase 1
Synonyms2610005A10Rik
MMRRC Submission
Accession Numbers

Genbank: NM_028105; MGI:1919363

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6915 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location88360554-88461724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88455620 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 334 (L334I)
Ref Sequence ENSEMBL: ENSMUSP00000152821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101165] [ENSMUST00000166940] [ENSMUST00000222695]
Predicted Effect probably damaging
Transcript: ENSMUST00000101165
AA Change: L334I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000098724
Gene: ENSMUSG00000021044
AA Change: L334I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
Pfam:ABC1 136 252 1.7e-42 PFAM
Pfam:Pkinase 150 348 1.3e-5 PFAM
low complexity region 498 508 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166940
AA Change: L334I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127254
Gene: ENSMUSG00000021044
AA Change: L334I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
Pfam:ABC1 136 252 2.2e-42 PFAM
Pfam:Pkinase 150 357 6.2e-6 PFAM
low complexity region 498 508 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222695
AA Change: L334I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T A 5: 3,960,551 M436K probably benign Het
Ankmy1 A C 1: 92,888,451 F314V probably null Het
Arid5b G A 10: 68,186,212 Q183* probably null Het
Atp8b4 A T 2: 126,358,914 L778* probably null Het
BC024139 G T 15: 76,120,021 N739K probably benign Het
Carns1 T G 19: 4,169,913 H441P probably benign Het
Cfap70 T A 14: 20,409,085 I693F probably benign Het
Cldn3 A G 5: 134,986,572 Q43R probably damaging Het
Col7a1 C T 9: 108,967,618 P1608L probably benign Het
Cr2 T A 1: 195,171,146 Y28F probably benign Het
Cyp2c38 T A 19: 39,436,068 I269F probably damaging Het
Dapk1 A T 13: 60,696,442 I92F probably damaging Het
Dennd4a T A 9: 64,852,489 L292* probably null Het
Dhx38 T C 8: 109,559,599 E353G probably benign Het
Dnm3 T C 1: 162,318,397 probably null Het
Dzip3 T C 16: 48,942,125 I794V possibly damaging Het
Eif2b5 T A 16: 20,502,750 V351D possibly damaging Het
Epg5 T A 18: 77,979,165 V1041E probably benign Het
Exoc4 A G 6: 33,921,453 K869R possibly damaging Het
Fat3 C A 9: 16,377,748 V160F probably benign Het
Gak A T 5: 108,602,950 Y365N probably benign Het
Ghrhr T A 6: 55,383,119 probably null Het
Gm21738 A G 14: 19,415,933 M202T probably benign Het
Gm6583 A T 5: 112,354,657 W394R probably damaging Het
Havcr2 C T 11: 46,475,911 S177L probably benign Het
Hkdc1 G C 10: 62,401,932 R353G possibly damaging Het
Ifi208 G A 1: 173,682,878 G200S probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lair1 A T 7: 4,055,953 V12E possibly damaging Het
Lipo3 T C 19: 33,584,893 N26D probably damaging Het
Lyst T A 13: 13,726,044 D3168E probably benign Het
Map6 G A 7: 99,268,247 A76T probably damaging Het
Mcoln3 A T 3: 146,137,256 probably null Het
Muc4 T C 16: 32,766,938 F2718L probably benign Het
Nek11 C G 9: 105,393,057 probably benign Het
Olfr1428 A G 19: 12,109,126 V140A probably benign Het
Olfr372 C A 8: 72,057,730 L17I probably benign Het
Olfr964-ps1 T C 9: 39,686,536 E136G unknown Het
Pcdh15 A T 10: 74,643,809 E846V probably benign Het
Pcdhga8 C T 18: 37,725,945 T18M probably benign Het
Per3 T C 4: 151,043,649 M61V possibly damaging Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pitpnm1 A G 19: 4,106,947 Y490C possibly damaging Het
Plcb4 A T 2: 135,947,115 I272F possibly damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prkce G C 17: 86,493,407 G417A probably damaging Het
Ptar1 A G 19: 23,703,137 N106D probably damaging Het
Rbm15 C A 3: 107,332,311 R257L probably benign Het
Rptor T G 11: 119,756,345 M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 W350R probably damaging Het
Ryr2 T G 13: 11,745,601 Y1532S probably damaging Het
Serpina1a C A 12: 103,853,851 V379L possibly damaging Het
Sox8 C T 17: 25,567,914 V272I probably damaging Het
Spert T A 14: 75,592,658 T32S probably benign Het
Stard9 C T 2: 120,702,630 H3123Y probably benign Het
Taar9 C T 10: 24,109,012 E175K possibly damaging Het
Tinag T A 9: 77,001,615 Y348F probably damaging Het
Tktl2 T C 8: 66,513,035 I415T probably damaging Het
Tm7sf2 G T 19: 6,068,312 R718S probably damaging Het
Tmem229a G T 6: 24,954,658 Q366K probably benign Het
Txndc2 T C 17: 65,638,291 D297G probably benign Het
Ulk4 A G 9: 121,258,820 F269L probably benign Het
Vps39 A T 2: 120,321,031 Y738* probably null Het
Other mutations in Adck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Adck1 APN 12 88368422 missense probably benign 0.00
IGL00822:Adck1 APN 12 88455516 missense probably damaging 0.99
IGL01370:Adck1 APN 12 88456733 splice site probably benign
IGL01480:Adck1 APN 12 88456865 nonsense probably null
IGL01994:Adck1 APN 12 88431156 missense possibly damaging 0.50
IGL02089:Adck1 APN 12 88446710 missense probably damaging 0.96
IGL03058:Adck1 APN 12 88459130 missense probably benign
IGL03196:Adck1 APN 12 88431115 missense probably damaging 1.00
IGL03307:Adck1 APN 12 88459053 missense possibly damaging 0.94
full-figured UTSW 12 88441117 missense possibly damaging 0.63
0152:Adck1 UTSW 12 88431151 missense probably benign 0.03
R0107:Adck1 UTSW 12 88446656 missense possibly damaging 0.62
R0164:Adck1 UTSW 12 88455510 missense probably damaging 0.99
R0164:Adck1 UTSW 12 88455510 missense probably damaging 0.99
R0179:Adck1 UTSW 12 88459172 missense possibly damaging 0.91
R0505:Adck1 UTSW 12 88371691 splice site probably benign
R0561:Adck1 UTSW 12 88368434 missense possibly damaging 0.49
R0831:Adck1 UTSW 12 88368348 start codon destroyed probably null 1.00
R1005:Adck1 UTSW 12 88402102 missense probably damaging 0.98
R1524:Adck1 UTSW 12 88402084 missense probably damaging 1.00
R2016:Adck1 UTSW 12 88461092 missense probably damaging 1.00
R4438:Adck1 UTSW 12 88431150 nonsense probably null
R4745:Adck1 UTSW 12 88402179 splice site probably null
R4827:Adck1 UTSW 12 88446719 missense probably benign 0.06
R4859:Adck1 UTSW 12 88441095 missense probably benign 0.02
R4885:Adck1 UTSW 12 88441095 missense probably benign 0.02
R4921:Adck1 UTSW 12 88441138 missense probably benign 0.10
R5383:Adck1 UTSW 12 88455603 missense probably benign 0.04
R5958:Adck1 UTSW 12 88459052 missense probably benign 0.33
R6028:Adck1 UTSW 12 88402132 missense probably benign
R6199:Adck1 UTSW 12 88441117 missense possibly damaging 0.63
R6317:Adck1 UTSW 12 88402151 missense probably damaging 1.00
R6616:Adck1 UTSW 12 88461188 missense unknown
R6715:Adck1 UTSW 12 88459080 missense probably damaging 1.00
R7295:Adck1 UTSW 12 88431045 missense probably damaging 1.00
R7387:Adck1 UTSW 12 88461052 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATAGGCAGGGCAGAACTCC -3'
(R):5'- GGACCCTCTGGATTCCATCTAC -3'

Sequencing Primer
(F):5'- AGAACTCCCAGTGGGTCACTTC -3'
(R):5'- TCATGCTAGCTGCCTGAAAG -3'
Posted On2018-11-06