Incidental Mutation 'R6915:Tm7sf2'
ID539316
Institutional Source Beutler Lab
Gene Symbol Tm7sf2
Ensembl Gene ENSMUSG00000024799
Gene Nametransmembrane 7 superfamily member 2
Synonyms3110041O18Rik, ANG1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6915 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6062821-6077197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 6068312 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 718 (R718S)
Ref Sequence ENSEMBL: ENSMUSP00000123994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025711] [ENSMUST00000025713] [ENSMUST00000113543] [ENSMUST00000159084] [ENSMUST00000159832] [ENSMUST00000160028] [ENSMUST00000160233] [ENSMUST00000161090] [ENSMUST00000161528] [ENSMUST00000161718] [ENSMUST00000162575] [ENSMUST00000162810]
Predicted Effect probably damaging
Transcript: ENSMUST00000025711
AA Change: R718S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025711
Gene: ENSMUSG00000024799
AA Change: R718S

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2.6e-10 PFAM
Pfam:DUF2450 62 250 2.3e-14 PFAM
Pfam:Vps51 63 149 1.1e-26 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Zw10 83 291 2.2e-8 PFAM
Pfam:Sec5 101 275 6.5e-24 PFAM
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025713
SMART Domains Protein: ENSMUSP00000025713
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 418 1.6e-141 PFAM
Pfam:DUF1295 250 409 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113543
SMART Domains Protein: ENSMUSP00000109171
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 373 9.9e-112 PFAM
Pfam:DUF1295 249 396 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159084
SMART Domains Protein: ENSMUSP00000124868
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 300 6.4e-75 PFAM
Pfam:ERG4_ERG24 292 391 2.2e-48 PFAM
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000159832
AA Change: R718S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123994
Gene: ENSMUSG00000024797
AA Change: R718S

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2e-10 PFAM
Pfam:DUF2450 62 250 1.9e-14 PFAM
Pfam:Vps51 63 149 8.3e-27 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Sec5 101 275 1.6e-19 PFAM
low complexity region 276 292 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160028
SMART Domains Protein: ENSMUSP00000124847
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160233
SMART Domains Protein: ENSMUSP00000124842
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161090
SMART Domains Protein: ENSMUSP00000125543
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161528
SMART Domains Protein: ENSMUSP00000123989
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 109 5.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161718
SMART Domains Protein: ENSMUSP00000124283
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 1 197 5.7e-86 PFAM
Pfam:DUF1295 46 185 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162575
SMART Domains Protein: ENSMUSP00000125586
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:ERG4_ERG24 51 229 5.5e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162810
SMART Domains Protein: ENSMUSP00000124825
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 9 124 6.9e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.3%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal plasma cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck1 C A 12: 88,455,620 L334I probably damaging Het
Akap9 T A 5: 3,960,551 M436K probably benign Het
Ankmy1 A C 1: 92,888,451 F314V probably null Het
Arid5b G A 10: 68,186,212 Q183* probably null Het
Atp8b4 A T 2: 126,358,914 L778* probably null Het
BC024139 G T 15: 76,120,021 N739K probably benign Het
Carns1 T G 19: 4,169,913 H441P probably benign Het
Cfap70 T A 14: 20,409,085 I693F probably benign Het
Cldn3 A G 5: 134,986,572 Q43R probably damaging Het
Col7a1 C T 9: 108,967,618 P1608L probably benign Het
Cr2 T A 1: 195,171,146 Y28F probably benign Het
Cyp2c38 T A 19: 39,436,068 I269F probably damaging Het
Dapk1 A T 13: 60,696,442 I92F probably damaging Het
Dennd4a T A 9: 64,852,489 L292* probably null Het
Dhx38 T C 8: 109,559,599 E353G probably benign Het
Dnm3 T C 1: 162,318,397 probably null Het
Dzip3 T C 16: 48,942,125 I794V possibly damaging Het
Eif2b5 T A 16: 20,502,750 V351D possibly damaging Het
Epg5 T A 18: 77,979,165 V1041E probably benign Het
Exoc4 A G 6: 33,921,453 K869R possibly damaging Het
Fat3 C A 9: 16,377,748 V160F probably benign Het
Gak A T 5: 108,602,950 Y365N probably benign Het
Ghrhr T A 6: 55,383,119 probably null Het
Gm21738 A G 14: 19,415,933 M202T probably benign Het
Gm6583 A T 5: 112,354,657 W394R probably damaging Het
Havcr2 C T 11: 46,475,911 S177L probably benign Het
Hkdc1 G C 10: 62,401,932 R353G possibly damaging Het
Ifi208 G A 1: 173,682,878 G200S probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lair1 A T 7: 4,055,953 V12E possibly damaging Het
Lipo3 T C 19: 33,584,893 N26D probably damaging Het
Lyst T A 13: 13,726,044 D3168E probably benign Het
Map6 G A 7: 99,268,247 A76T probably damaging Het
Mcoln3 A T 3: 146,137,256 probably null Het
Muc4 T C 16: 32,766,938 F2718L probably benign Het
Nek11 C G 9: 105,393,057 probably benign Het
Olfr1428 A G 19: 12,109,126 V140A probably benign Het
Olfr372 C A 8: 72,057,730 L17I probably benign Het
Olfr964-ps1 T C 9: 39,686,536 E136G unknown Het
Pcdh15 A T 10: 74,643,809 E846V probably benign Het
Pcdhga8 C T 18: 37,725,945 T18M probably benign Het
Per3 T C 4: 151,043,649 M61V possibly damaging Het
Pfas C T 11: 68,992,181 R759Q probably benign Het
Pitpnm1 A G 19: 4,106,947 Y490C possibly damaging Het
Plcb4 A T 2: 135,947,115 I272F possibly damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prkce G C 17: 86,493,407 G417A probably damaging Het
Ptar1 A G 19: 23,703,137 N106D probably damaging Het
Rbm15 C A 3: 107,332,311 R257L probably benign Het
Rptor T G 11: 119,756,345 M254R probably damaging Het
Runx1t1 T A 4: 13,865,257 W350R probably damaging Het
Ryr2 T G 13: 11,745,601 Y1532S probably damaging Het
Serpina1a C A 12: 103,853,851 V379L possibly damaging Het
Sox8 C T 17: 25,567,914 V272I probably damaging Het
Spert T A 14: 75,592,658 T32S probably benign Het
Stard9 C T 2: 120,702,630 H3123Y probably benign Het
Taar9 C T 10: 24,109,012 E175K possibly damaging Het
Tinag T A 9: 77,001,615 Y348F probably damaging Het
Tktl2 T C 8: 66,513,035 I415T probably damaging Het
Tmem229a G T 6: 24,954,658 Q366K probably benign Het
Txndc2 T C 17: 65,638,291 D297G probably benign Het
Ulk4 A G 9: 121,258,820 F269L probably benign Het
Vps39 A T 2: 120,321,031 Y738* probably null Het
Other mutations in Tm7sf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02292:Tm7sf2 APN 19 6063568 missense probably damaging 1.00
IGL03299:Tm7sf2 APN 19 6062928 missense probably benign 0.03
PIT4791001:Tm7sf2 UTSW 19 6063605 missense probably benign 0.00
R0033:Tm7sf2 UTSW 19 6066422 splice site probably benign
R0033:Tm7sf2 UTSW 19 6066422 splice site probably benign
R1607:Tm7sf2 UTSW 19 6063019 unclassified probably null
R3415:Tm7sf2 UTSW 19 6063599 missense probably damaging 1.00
R5392:Tm7sf2 UTSW 19 6063968 missense probably damaging 1.00
R5835:Tm7sf2 UTSW 19 6063884 missense probably damaging 1.00
R5886:Tm7sf2 UTSW 19 6066542 unclassified probably benign
R6065:Tm7sf2 UTSW 19 6063386 missense possibly damaging 0.65
R6300:Tm7sf2 UTSW 19 6067200 missense probably damaging 1.00
R7037:Tm7sf2 UTSW 19 6064077 critical splice donor site probably null
R7073:Tm7sf2 UTSW 19 6066497 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACACTAGGTTCCATGGGCAC -3'
(R):5'- ATGAGGCCCCATCTCTGATC -3'

Sequencing Primer
(F):5'- TTCCATGGGCACTGGGTC -3'
(R):5'- ATCTCTGATCTGACCACCGGG -3'
Posted On2018-11-06