Incidental Mutation 'R6916:Wipf1'
ID539325
Institutional Source Beutler Lab
Gene Symbol Wipf1
Ensembl Gene ENSMUSG00000075284
Gene NameWAS/WASL interacting protein family, member 1
SynonymsWIP, D2Ertd120e, Waspip
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R6916 (G1)
Quality Score167.009
Status Validated
Chromosome2
Chromosomal Location73429610-73529734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73437404 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 217 (G217W)
Ref Sequence ENSEMBL: ENSMUSP00000099741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094681] [ENSMUST00000102679] [ENSMUST00000102680] [ENSMUST00000141264]
Predicted Effect probably damaging
Transcript: ENSMUST00000094681
AA Change: G217W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092268
Gene: ENSMUSG00000075284
AA Change: G217W

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WH2 32 49 9.78e-4 SMART
low complexity region 64 108 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
low complexity region 232 249 N/A INTRINSIC
low complexity region 274 317 N/A INTRINSIC
low complexity region 329 374 N/A INTRINSIC
low complexity region 398 424 N/A INTRINSIC
PDB:2IFS|A 441 470 1e-11 PDB
low complexity region 471 484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102679
AA Change: G217W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099740
Gene: ENSMUSG00000075284
AA Change: G217W

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WH2 32 49 9.78e-4 SMART
low complexity region 64 108 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
low complexity region 232 249 N/A INTRINSIC
low complexity region 274 317 N/A INTRINSIC
low complexity region 329 374 N/A INTRINSIC
low complexity region 398 424 N/A INTRINSIC
PDB:2IFS|A 441 470 1e-11 PDB
low complexity region 471 484 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102680
AA Change: G217W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099741
Gene: ENSMUSG00000075284
AA Change: G217W

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WH2 32 49 9.78e-4 SMART
low complexity region 64 108 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
low complexity region 232 249 N/A INTRINSIC
low complexity region 274 317 N/A INTRINSIC
low complexity region 329 374 N/A INTRINSIC
low complexity region 398 424 N/A INTRINSIC
PDB:2IFS|A 441 470 1e-11 PDB
low complexity region 471 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141264
SMART Domains Protein: ENSMUSP00000119190
Gene: ENSMUSG00000075284

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WH2 32 49 9.78e-4 SMART
low complexity region 64 108 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays an important role in the organization of the actin cytoskeleton. The encoded protein binds to a region of Wiskott-Aldrich syndrome protein that is frequently mutated in Wiskott-Aldrich syndrome, an X-linked recessive disorder. Impairment of the interaction between these two proteins may contribute to the disease. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have immunological abnormalities, although lymphocyte development appears normal. Mutants show abnormal B and T cell proliferative responses, high serum immunoglobulin levels and impaired immunological synapse formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,931,053 I329N probably benign Het
2700049A03Rik T A 12: 71,164,544 I684K possibly damaging Het
Abcg3 T A 5: 104,974,735 R97S probably benign Het
Acin1 A T 14: 54,665,416 F160L probably benign Het
Asb10 T C 5: 24,537,856 D293G probably damaging Het
Atp6v1c1 T C 15: 38,677,581 S117P probably benign Het
Bahcc1 T A 11: 120,273,009 V711E probably damaging Het
Baz2b A T 2: 59,968,776 S335T probably benign Het
Bdkrb2 C T 12: 105,591,779 A93V probably damaging Het
Cacna1d A T 14: 30,095,364 V1247D probably damaging Het
Cenpb A C 2: 131,179,624 F85V probably benign Het
Cep112 C A 11: 108,859,376 Q142K probably damaging Het
Ciita T A 16: 10,509,207 probably null Het
Cnr1 A G 4: 33,943,897 D95G probably benign Het
Ctnnd1 A T 2: 84,609,646 D767E probably benign Het
Ddx20 T C 3: 105,680,613 N384D probably damaging Het
Dnaaf3 T A 7: 4,527,533 D191V probably damaging Het
Efna1 T C 3: 89,276,388 N44D possibly damaging Het
Errfi1 A T 4: 150,867,473 K453* probably null Het
Fam149a C A 8: 45,350,406 K349N probably damaging Het
Fbxl20 T A 11: 98,113,253 I70L possibly damaging Het
Flnb C T 14: 7,907,171 T1248I probably damaging Het
Frem2 T C 3: 53,547,688 R2156G probably damaging Het
Ftl1 T C 7: 45,459,540 Y31C probably damaging Het
Gm5862 G T 5: 26,019,348 H208N probably benign Het
Hc A T 2: 35,010,032 Y1096* probably null Het
Hps1 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 19: 42,766,725 Het
Ints3 T C 3: 90,406,334 D329G probably damaging Het
Irak3 A T 10: 120,201,365 L32Q probably damaging Het
Kif1bp T C 10: 62,566,064 T20A probably benign Het
Klrb1f A T 6: 129,053,811 D95V probably benign Het
Krt79 C T 15: 101,936,170 D260N probably benign Het
Lrp11 C A 10: 7,608,714 probably null Het
Lrrc10 C A 10: 117,045,549 R43S possibly damaging Het
Muc5b A T 7: 141,864,717 Y3800F possibly damaging Het
Myh14 T C 7: 44,629,313 K1003E probably damaging Het
Nbeal2 A G 9: 110,626,108 I2567T probably damaging Het
Necab2 G T 8: 119,467,616 R277L probably damaging Het
Nell1 T C 7: 50,701,179 Y525H probably benign Het
Olfm4 T A 14: 80,014,198 M186K probably damaging Het
Olfr389 T A 11: 73,777,069 Q86L probably benign Het
Olfr753-ps1 T C 17: 37,169,973 K225R probably benign Het
Olfr934 T C 9: 38,982,904 I47V probably benign Het
Pcdhb11 A T 18: 37,422,381 S255C possibly damaging Het
Rrbp1 A T 2: 143,974,598 C704S probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sh2d3c C T 2: 32,752,653 R552* probably null Het
Sh3d19 A G 3: 86,084,911 E82G probably benign Het
Son T A 16: 91,654,785 L140Q probably damaging Het
Svil G A 18: 5,114,682 probably benign Het
Syne1 T C 10: 5,227,912 K4854R probably benign Het
Tmem202 C A 9: 59,525,474 probably benign Het
Tmem56 T C 3: 121,207,156 D276G possibly damaging Het
Trak2 T C 1: 58,910,025 T539A probably benign Het
Trdn T C 10: 33,157,018 S80P probably damaging Het
Ugt2b37 T A 5: 87,254,600 R57S probably benign Het
Usp34 G A 11: 23,458,023 R2616Q probably damaging Het
Usp48 T C 4: 137,638,233 Y113H probably damaging Het
Vtcn1 G T 3: 100,888,163 probably null Het
Wdr19 G A 5: 65,225,334 R467Q possibly damaging Het
Wdr72 A G 9: 74,155,039 Y489C probably benign Het
Other mutations in Wipf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Wipf1 APN 2 73447881 missense unknown
IGL02391:Wipf1 APN 2 73434143 missense probably damaging 1.00
IGL02992:Wipf1 APN 2 73434083 missense probably damaging 1.00
PIT1430001:Wipf1 UTSW 2 73437602 missense probably damaging 1.00
R1553:Wipf1 UTSW 2 73437526 missense possibly damaging 0.96
R1920:Wipf1 UTSW 2 73440155 missense probably benign 0.11
R3154:Wipf1 UTSW 2 73437490 missense possibly damaging 0.86
R3161:Wipf1 UTSW 2 73434949 missense probably damaging 0.99
R3975:Wipf1 UTSW 2 73437169 missense probably benign 0.00
R4996:Wipf1 UTSW 2 73440074 unclassified probably benign
R5218:Wipf1 UTSW 2 73444468 missense probably damaging 1.00
R7006:Wipf1 UTSW 2 73437097 missense probably damaging 1.00
R7259:Wipf1 UTSW 2 73435081 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGCACTGGAGGTTTGCTG -3'
(R):5'- AGATTCTGGAGGAAGCCGAC -3'

Sequencing Primer
(F):5'- CACTGGAGGTTTGCTGGTCTG -3'
(R):5'- GAAGCCGACCACCGATTTTG -3'
Posted On2018-11-06