Incidental Mutation 'R6916:Ctnnd1'
ID539326
Institutional Source Beutler Lab
Gene Symbol Ctnnd1
Ensembl Gene ENSMUSG00000034101
Gene Namecatenin (cadherin associated protein), delta 1
SynonymsP120, p120-catenin, Ctnnd, Catns
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6916 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location84600071-84650765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84609646 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 767 (D767E)
Ref Sequence ENSEMBL: ENSMUSP00000065252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036811] [ENSMUST00000066177] [ENSMUST00000067232] [ENSMUST00000099941] [ENSMUST00000111670] [ENSMUST00000111675] [ENSMUST00000111676] [ENSMUST00000111677] [ENSMUST00000111678] [ENSMUST00000111684] [ENSMUST00000111685] [ENSMUST00000111686] [ENSMUST00000111687] [ENSMUST00000111688] [ENSMUST00000111689] [ENSMUST00000111690] [ENSMUST00000111691] [ENSMUST00000111692] [ENSMUST00000111693] [ENSMUST00000111694] [ENSMUST00000111695] [ENSMUST00000111696] [ENSMUST00000111697] [ENSMUST00000111698] [ENSMUST00000189772]
Predicted Effect probably benign
Transcript: ENSMUST00000036811
AA Change: D773E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000042543
Gene: ENSMUSG00000034101
AA Change: D773E

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066177
AA Change: D767E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000065252
Gene: ENSMUSG00000034101
AA Change: D767E

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 1.2e-8 SMART
ARM 440 481 1.3e-10 SMART
ARM 482 539 3e-1 SMART
ARM 541 588 1.8e-2 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 5.7e-7 SMART
ARM 783 825 2.1e-1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067232
AA Change: D773E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000064518
Gene: ENSMUSG00000034101
AA Change: D773E

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099941
AA Change: D672E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097524
Gene: ENSMUSG00000034101
AA Change: D672E

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 550 592 8e-20 BLAST
ARM 598 638 1.23e-4 SMART
ARM 688 730 4.41e1 SMART
low complexity region 756 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111670
AA Change: D666E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107299
Gene: ENSMUSG00000034101
AA Change: D666E

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 544 586 9e-20 BLAST
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111675
AA Change: D444E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107304
Gene: ENSMUSG00000034101
AA Change: D444E

DomainStartEndE-ValueType
ARM 74 114 2.53e-6 SMART
ARM 117 158 2.8e-8 SMART
ARM 159 216 6.3e1 SMART
ARM 218 265 3.74e0 SMART
Blast:ARM 322 364 8e-20 BLAST
ARM 370 410 1.23e-4 SMART
ARM 460 502 4.41e1 SMART
low complexity region 528 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111676
AA Change: D666E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107305
Gene: ENSMUSG00000034101
AA Change: D666E

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 544 586 1e-19 BLAST
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
low complexity region 836 848 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111677
AA Change: D666E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107306
Gene: ENSMUSG00000034101
AA Change: D666E

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
ARM 592 632 1.23e-4 SMART
ARM 682 724 4.41e1 SMART
low complexity region 750 761 N/A INTRINSIC
low complexity region 815 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111678
AA Change: D672E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000107307
Gene: ENSMUSG00000034101
AA Change: D672E

DomainStartEndE-ValueType
low complexity region 25 52 N/A INTRINSIC
ARM 296 336 2.53e-6 SMART
ARM 339 380 2.8e-8 SMART
ARM 381 438 6.3e1 SMART
ARM 440 487 3.74e0 SMART
Blast:ARM 550 592 9e-20 BLAST
ARM 598 638 1.23e-4 SMART
ARM 688 730 4.41e1 SMART
low complexity region 756 767 N/A INTRINSIC
low complexity region 842 854 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111684
AA Change: D719E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000107313
Gene: ENSMUSG00000034101
AA Change: D719E

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
low complexity region 889 901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111685
AA Change: D719E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107314
Gene: ENSMUSG00000034101
AA Change: D719E

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111686
AA Change: D713E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107315
Gene: ENSMUSG00000034101
AA Change: D713E

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111687
AA Change: D713E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107316
Gene: ENSMUSG00000034101
AA Change: D713E

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 8e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
low complexity region 883 895 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111688
AA Change: D713E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107317
Gene: ENSMUSG00000034101
AA Change: D713E

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111689
AA Change: D719E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107318
Gene: ENSMUSG00000034101
AA Change: D719E

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 597 639 6e-20 BLAST
ARM 645 685 1.23e-4 SMART
ARM 735 777 4.41e1 SMART
low complexity region 803 814 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111690
AA Change: D713E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107319
Gene: ENSMUSG00000034101
AA Change: D713E

DomainStartEndE-ValueType
low complexity region 72 99 N/A INTRINSIC
ARM 343 383 2.53e-6 SMART
ARM 386 427 2.8e-8 SMART
ARM 428 485 6.3e1 SMART
ARM 487 534 3.74e0 SMART
Blast:ARM 591 633 7e-20 BLAST
ARM 639 679 1.23e-4 SMART
ARM 729 771 4.41e1 SMART
low complexity region 797 808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111691
AA Change: D773E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107320
Gene: ENSMUSG00000034101
AA Change: D773E

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111692
AA Change: D767E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107321
Gene: ENSMUSG00000034101
AA Change: D767E

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111693
AA Change: D767E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107322
Gene: ENSMUSG00000034101
AA Change: D767E

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111694
AA Change: D773E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000107323
Gene: ENSMUSG00000034101
AA Change: D773E

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
low complexity region 943 955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111695
AA Change: D767E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107324
Gene: ENSMUSG00000034101
AA Change: D767E

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
low complexity region 937 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111696
AA Change: D767E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107325
Gene: ENSMUSG00000034101
AA Change: D767E

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 645 687 1e-19 BLAST
ARM 693 733 1.23e-4 SMART
ARM 783 825 4.41e1 SMART
low complexity region 851 862 N/A INTRINSIC
low complexity region 916 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111697
AA Change: D773E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107326
Gene: ENSMUSG00000034101
AA Change: D773E

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111698
AA Change: D703E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107327
Gene: ENSMUSG00000034101
AA Change: D703E

DomainStartEndE-ValueType
low complexity region 62 89 N/A INTRINSIC
ARM 333 373 2.53e-6 SMART
ARM 376 417 2.8e-8 SMART
ARM 418 475 6.3e1 SMART
ARM 477 524 3.74e0 SMART
Blast:ARM 581 623 8e-20 BLAST
ARM 629 669 1.23e-4 SMART
ARM 719 761 4.41e1 SMART
low complexity region 787 798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189772
AA Change: D773E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000141166
Gene: ENSMUSG00000101645
AA Change: D773E

DomainStartEndE-ValueType
coiled coil region 10 45 N/A INTRINSIC
low complexity region 126 153 N/A INTRINSIC
ARM 397 437 2.53e-6 SMART
ARM 440 481 2.8e-8 SMART
ARM 482 539 6.3e1 SMART
ARM 541 588 3.74e0 SMART
Blast:ARM 651 693 9e-20 BLAST
ARM 699 739 1.23e-4 SMART
ARM 789 831 4.41e1 SMART
low complexity region 857 868 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Armadillo protein family, which function in adhesion between cells and signal transduction. Multiple translation initiation codons and alternative splicing result in many different isoforms being translated. Not all of the full-length natures of the described transcript variants have been determined. Read-through transcription also exists between this gene and the neighboring upstream thioredoxin-related transmembrane protein 2 (TMX2) gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene die shortly after birth and have morphological abnormalities of the salivary glands and lacrimal gland. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,931,053 I329N probably benign Het
2700049A03Rik T A 12: 71,164,544 I684K possibly damaging Het
Abcg3 T A 5: 104,974,735 R97S probably benign Het
Acin1 A T 14: 54,665,416 F160L probably benign Het
Asb10 T C 5: 24,537,856 D293G probably damaging Het
Atp6v1c1 T C 15: 38,677,581 S117P probably benign Het
Bahcc1 T A 11: 120,273,009 V711E probably damaging Het
Baz2b A T 2: 59,968,776 S335T probably benign Het
Bdkrb2 C T 12: 105,591,779 A93V probably damaging Het
Cacna1d A T 14: 30,095,364 V1247D probably damaging Het
Cenpb A C 2: 131,179,624 F85V probably benign Het
Cep112 C A 11: 108,859,376 Q142K probably damaging Het
Cnr1 A G 4: 33,943,897 D95G probably benign Het
Ddx20 T C 3: 105,680,613 N384D probably damaging Het
Dnaaf3 T A 7: 4,527,533 D191V probably damaging Het
Efna1 T C 3: 89,276,388 N44D possibly damaging Het
Errfi1 A T 4: 150,867,473 K453* probably null Het
Fam149a C A 8: 45,350,406 K349N probably damaging Het
Fbxl20 T A 11: 98,113,253 I70L possibly damaging Het
Flnb C T 14: 7,907,171 T1248I probably damaging Het
Frem2 T C 3: 53,547,688 R2156G probably damaging Het
Ftl1 T C 7: 45,459,540 Y31C probably damaging Het
Gm5862 G T 5: 26,019,348 H208N probably benign Het
Hc A T 2: 35,010,032 Y1096* probably null Het
Hps1 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 19: 42,766,725 Het
Ints3 T C 3: 90,406,334 D329G probably damaging Het
Irak3 A T 10: 120,201,365 L32Q probably damaging Het
Kif1bp T C 10: 62,566,064 T20A probably benign Het
Klrb1f A T 6: 129,053,811 D95V probably benign Het
Krt79 C T 15: 101,936,170 D260N probably benign Het
Lrp11 C A 10: 7,608,714 probably null Het
Lrrc10 C A 10: 117,045,549 R43S possibly damaging Het
Muc5b A T 7: 141,864,717 Y3800F possibly damaging Het
Myh14 T C 7: 44,629,313 K1003E probably damaging Het
Nbeal2 A G 9: 110,626,108 I2567T probably damaging Het
Necab2 G T 8: 119,467,616 R277L probably damaging Het
Nell1 T C 7: 50,701,179 Y525H probably benign Het
Olfm4 T A 14: 80,014,198 M186K probably damaging Het
Olfr389 T A 11: 73,777,069 Q86L probably benign Het
Olfr753-ps1 T C 17: 37,169,973 K225R probably benign Het
Olfr934 T C 9: 38,982,904 I47V probably benign Het
Pcdhb11 A T 18: 37,422,381 S255C possibly damaging Het
Rrbp1 A T 2: 143,974,598 C704S probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sh2d3c C T 2: 32,752,653 R552* probably null Het
Sh3d19 A G 3: 86,084,911 E82G probably benign Het
Son T A 16: 91,654,785 L140Q probably damaging Het
Syne1 T C 10: 5,227,912 K4854R probably benign Het
Tmem202 C A 9: 59,525,474 probably benign Het
Tmem56 T C 3: 121,207,156 D276G possibly damaging Het
Trak2 T C 1: 58,910,025 T539A probably benign Het
Trdn T C 10: 33,157,018 S80P probably damaging Het
Ugt2b37 T A 5: 87,254,600 R57S probably benign Het
Usp34 G A 11: 23,458,023 R2616Q probably damaging Het
Usp48 T C 4: 137,638,233 Y113H probably damaging Het
Vtcn1 G T 3: 100,888,163 probably null Het
Wdr19 G A 5: 65,225,334 R467Q possibly damaging Het
Wdr72 A G 9: 74,155,039 Y489C probably benign Het
Wipf1 C A 2: 73,437,404 G217W probably damaging Het
Other mutations in Ctnnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Ctnnd1 APN 2 84609625 missense probably damaging 0.99
IGL00846:Ctnnd1 APN 2 84622010 critical splice donor site probably null
IGL00861:Ctnnd1 APN 2 84603752 missense probably damaging 0.97
IGL01394:Ctnnd1 APN 2 84605256 splice site probably benign
IGL02035:Ctnnd1 APN 2 84620081 missense probably damaging 1.00
IGL02536:Ctnnd1 APN 2 84605196 missense probably benign 0.00
IGL02859:Ctnnd1 APN 2 84619909 splice site probably benign
IGL03270:Ctnnd1 APN 2 84609727 splice site probably null
IGL02802:Ctnnd1 UTSW 2 84624462 start codon destroyed probably null 0.99
R0449:Ctnnd1 UTSW 2 84603262 missense possibly damaging 0.53
R0487:Ctnnd1 UTSW 2 84609067 missense probably damaging 1.00
R0652:Ctnnd1 UTSW 2 84602896 missense probably benign 0.40
R1503:Ctnnd1 UTSW 2 84605179 splice site probably null
R1701:Ctnnd1 UTSW 2 84608991 missense probably damaging 1.00
R1796:Ctnnd1 UTSW 2 84615209 missense probably damaging 1.00
R2001:Ctnnd1 UTSW 2 84620360 missense probably benign 0.00
R2002:Ctnnd1 UTSW 2 84620360 missense probably benign 0.00
R2185:Ctnnd1 UTSW 2 84612548 missense probably damaging 1.00
R2192:Ctnnd1 UTSW 2 84609563 missense probably damaging 1.00
R2203:Ctnnd1 UTSW 2 84616680 missense probably damaging 1.00
R2389:Ctnnd1 UTSW 2 84624271 missense probably null 0.94
R2872:Ctnnd1 UTSW 2 84620888 missense possibly damaging 0.88
R2872:Ctnnd1 UTSW 2 84620888 missense possibly damaging 0.88
R3846:Ctnnd1 UTSW 2 84616927 missense probably benign 0.04
R4019:Ctnnd1 UTSW 2 84619958 missense probably damaging 1.00
R4194:Ctnnd1 UTSW 2 84603701 missense possibly damaging 0.93
R4796:Ctnnd1 UTSW 2 84619926 missense probably damaging 1.00
R4847:Ctnnd1 UTSW 2 84622052 nonsense probably null
R4964:Ctnnd1 UTSW 2 84622073 missense possibly damaging 0.85
R4966:Ctnnd1 UTSW 2 84622073 missense possibly damaging 0.85
R5223:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5336:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5428:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5429:Ctnnd1 UTSW 2 84616789 missense probably damaging 1.00
R5974:Ctnnd1 UTSW 2 84620915 nonsense probably null
R6018:Ctnnd1 UTSW 2 84650468 intron probably benign
R6285:Ctnnd1 UTSW 2 84613887 critical splice donor site probably null
R6562:Ctnnd1 UTSW 2 84624308 missense probably benign
R6661:Ctnnd1 UTSW 2 84609642 missense probably damaging 1.00
R6694:Ctnnd1 UTSW 2 84624505 start gained probably benign
R6769:Ctnnd1 UTSW 2 84619925 missense probably damaging 1.00
R6769:Ctnnd1 UTSW 2 84620110 missense probably damaging 1.00
R6771:Ctnnd1 UTSW 2 84619925 missense probably damaging 1.00
R6771:Ctnnd1 UTSW 2 84620110 missense probably damaging 1.00
X0062:Ctnnd1 UTSW 2 84615214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGAAGGGGCTGTAATCTC -3'
(R):5'- TTTGCGCCTTTGAGATAATCTC -3'

Sequencing Primer
(F):5'- TCTCACAGAATGGAAGAGGAAAATTC -3'
(R):5'- ATAATCTCATGTGATAATGGAGTTGG -3'
Posted On2018-11-06