Incidental Mutation 'R6916:Cenpb'
ID539327
Institutional Source Beutler Lab
Gene Symbol Cenpb
Ensembl Gene ENSMUSG00000068267
Gene Namecentromere protein B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R6916 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location131175182-131180067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 131179624 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 85 (F85V)
Ref Sequence ENSEMBL: ENSMUSP00000086938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028801] [ENSMUST00000089510] [ENSMUST00000110218]
Predicted Effect probably benign
Transcript: ENSMUST00000028801
SMART Domains Protein: ENSMUSP00000028801
Gene: ENSMUSG00000027329

DomainStartEndE-ValueType
Pfam:CH_2 13 109 9.3e-36 PFAM
Pfam:CAMSAP_CH 14 96 7.9e-24 PFAM
coiled coil region 182 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089510
AA Change: F85V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000086938
Gene: ENSMUSG00000068267
AA Change: F85V

DomainStartEndE-ValueType
Pfam:CENP-B_N 2 56 1.6e-26 PFAM
CENPB 71 136 7.05e-23 SMART
low complexity region 140 158 N/A INTRINSIC
Pfam:DDE_1 222 384 4.9e-44 PFAM
coiled coil region 402 439 N/A INTRINSIC
Pfam:CENP-B_dimeris 499 598 5.8e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110218
SMART Domains Protein: ENSMUSP00000105847
Gene: ENSMUSG00000027329

DomainStartEndE-ValueType
Pfam:CH 10 103 1.2e-7 PFAM
Pfam:DUF1042 13 164 5.7e-58 PFAM
Pfam:CAMSAP_CH 14 96 9e-23 PFAM
coiled coil region 182 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127987
SMART Domains Protein: ENSMUSP00000114178
Gene: ENSMUSG00000027329

DomainStartEndE-ValueType
Pfam:CH_2 7 103 1.7e-36 PFAM
Pfam:CAMSAP_CH 8 90 6e-24 PFAM
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a highly conserved protein that facilitates centromere formation. It is a DNA-binding protein that is derived from transposases of the pogo DNA transposon family. It contains a helix-loop-helix DNA binding motif at the N-terminus, and a dimerization domain at the C-terminus. The DNA binding domain recognizes and binds a 17-bp sequence (CENP-B box) in the centromeric alpha satellite DNA. This protein is proposed to play an important role in the assembly of specific centromere structures in interphase nuclei and on mitotic chromosomes. It is also considered a major centromere autoantigen recognized by sera from patients with anti-centromere antibodies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display decreased body weight, small testis, oligospermia, and an age- and background-dependent reduction in female reproductive competence associated with abnormalities in uterus morphology, metral environment, gestational length, and parturition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,931,053 I329N probably benign Het
2700049A03Rik T A 12: 71,164,544 I684K possibly damaging Het
Abcg3 T A 5: 104,974,735 R97S probably benign Het
Acin1 A T 14: 54,665,416 F160L probably benign Het
Asb10 T C 5: 24,537,856 D293G probably damaging Het
Atp6v1c1 T C 15: 38,677,581 S117P probably benign Het
Bahcc1 T A 11: 120,273,009 V711E probably damaging Het
Baz2b A T 2: 59,968,776 S335T probably benign Het
Bdkrb2 C T 12: 105,591,779 A93V probably damaging Het
Cacna1d A T 14: 30,095,364 V1247D probably damaging Het
Cep112 C A 11: 108,859,376 Q142K probably damaging Het
Ciita T A 16: 10,509,207 probably null Het
Cnr1 A G 4: 33,943,897 D95G probably benign Het
Ctnnd1 A T 2: 84,609,646 D767E probably benign Het
Ddx20 T C 3: 105,680,613 N384D probably damaging Het
Dnaaf3 T A 7: 4,527,533 D191V probably damaging Het
Efna1 T C 3: 89,276,388 N44D possibly damaging Het
Errfi1 A T 4: 150,867,473 K453* probably null Het
Fam149a C A 8: 45,350,406 K349N probably damaging Het
Fbxl20 T A 11: 98,113,253 I70L possibly damaging Het
Flnb C T 14: 7,907,171 T1248I probably damaging Het
Frem2 T C 3: 53,547,688 R2156G probably damaging Het
Ftl1 T C 7: 45,459,540 Y31C probably damaging Het
Gm5862 G T 5: 26,019,348 H208N probably benign Het
Hc A T 2: 35,010,032 Y1096* probably null Het
Hps1 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 19: 42,766,725 Het
Ints3 T C 3: 90,406,334 D329G probably damaging Het
Irak3 A T 10: 120,201,365 L32Q probably damaging Het
Kif1bp T C 10: 62,566,064 T20A probably benign Het
Klrb1f A T 6: 129,053,811 D95V probably benign Het
Krt79 C T 15: 101,936,170 D260N probably benign Het
Lrp11 C A 10: 7,608,714 probably null Het
Lrrc10 C A 10: 117,045,549 R43S possibly damaging Het
Muc5b A T 7: 141,864,717 Y3800F possibly damaging Het
Myh14 T C 7: 44,629,313 K1003E probably damaging Het
Nbeal2 A G 9: 110,626,108 I2567T probably damaging Het
Necab2 G T 8: 119,467,616 R277L probably damaging Het
Nell1 T C 7: 50,701,179 Y525H probably benign Het
Olfm4 T A 14: 80,014,198 M186K probably damaging Het
Olfr389 T A 11: 73,777,069 Q86L probably benign Het
Olfr753-ps1 T C 17: 37,169,973 K225R probably benign Het
Olfr934 T C 9: 38,982,904 I47V probably benign Het
Pcdhb11 A T 18: 37,422,381 S255C possibly damaging Het
Rrbp1 A T 2: 143,974,598 C704S probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sh2d3c C T 2: 32,752,653 R552* probably null Het
Sh3d19 A G 3: 86,084,911 E82G probably benign Het
Son T A 16: 91,654,785 L140Q probably damaging Het
Svil G A 18: 5,114,682 probably benign Het
Syne1 T C 10: 5,227,912 K4854R probably benign Het
Tmem202 C A 9: 59,525,474 probably benign Het
Tmem56 T C 3: 121,207,156 D276G possibly damaging Het
Trak2 T C 1: 58,910,025 T539A probably benign Het
Trdn T C 10: 33,157,018 S80P probably damaging Het
Ugt2b37 T A 5: 87,254,600 R57S probably benign Het
Usp34 G A 11: 23,458,023 R2616Q probably damaging Het
Usp48 T C 4: 137,638,233 Y113H probably damaging Het
Vtcn1 G T 3: 100,888,163 probably null Het
Wdr19 G A 5: 65,225,334 R467Q possibly damaging Het
Wdr72 A G 9: 74,155,039 Y489C probably benign Het
Wipf1 C A 2: 73,437,404 G217W probably damaging Het
Other mutations in Cenpb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02421:Cenpb APN 2 131179681 missense probably damaging 1.00
R0183:Cenpb UTSW 2 131178453 unclassified probably benign
R1378:Cenpb UTSW 2 131178310 unclassified probably benign
R1934:Cenpb UTSW 2 131179264 missense probably benign
R2086:Cenpb UTSW 2 131178597 unclassified probably benign
R2132:Cenpb UTSW 2 131179306 missense probably damaging 1.00
R4776:Cenpb UTSW 2 131178183 unclassified probably benign
R5056:Cenpb UTSW 2 131178171 unclassified probably benign
R5120:Cenpb UTSW 2 131179818 missense probably benign 0.00
R5617:Cenpb UTSW 2 131179014 missense probably damaging 0.99
R6297:Cenpb UTSW 2 131178369 unclassified probably benign
R6467:Cenpb UTSW 2 131179557 missense probably damaging 1.00
R6673:Cenpb UTSW 2 131179245 missense probably damaging 0.98
R7102:Cenpb UTSW 2 131178879 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGAAAGTCGTACCACAGGCTG -3'
(R):5'- AGAAGTCGCGGATCATCCAG -3'

Sequencing Primer
(F):5'- TGAACACGTCCTGCGAGG -3'
(R):5'- TGGAGGAGAACCCGGACCTAC -3'
Posted On2018-11-06