Incidental Mutation 'R6916:Errfi1'
ID539339
Institutional Source Beutler Lab
Gene Symbol Errfi1
Ensembl Gene ENSMUSG00000028967
Gene NameERBB receptor feedback inhibitor 1
SynonymsMig-6, RALT, 1300002F13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R6916 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location150853919-150868892 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 150867473 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 453 (K453*)
Ref Sequence ENSEMBL: ENSMUSP00000073285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030811] [ENSMUST00000073600]
Predicted Effect probably null
Transcript: ENSMUST00000030811
AA Change: K453*
SMART Domains Protein: ENSMUSP00000030811
Gene: ENSMUSG00000028967
AA Change: K453*

DomainStartEndE-ValueType
Pfam:GTPase_binding 4 67 5.5e-40 PFAM
low complexity region 171 186 N/A INTRINSIC
low complexity region 227 241 N/A INTRINSIC
low complexity region 279 295 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 314 370 9.5e-18 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000073600
AA Change: K453*
SMART Domains Protein: ENSMUSP00000073285
Gene: ENSMUSG00000028967
AA Change: K453*

DomainStartEndE-ValueType
Pfam:GTPase_binding 4 67 4.1e-36 PFAM
low complexity region 171 186 N/A INTRINSIC
low complexity region 227 241 N/A INTRINSIC
low complexity region 279 295 N/A INTRINSIC
Pfam:Inhibitor_Mig-6 314 371 6.2e-28 PFAM
Meta Mutation Damage Score 0.57 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ERRFI1 is a cytoplasmic protein whose expression is upregulated with cell growth (Wick et al., 1995 [PubMed 7641805]). It shares significant homology with the protein product of rat gene-33, which is induced during cell stress and mediates cell signaling (Makkinje et al., 2000 [PubMed 10749885]; Fiorentino et al., 2000 [PubMed 11003669]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene may lead to premature death, delayed eyelid opening, epidermal hyperplasia, degenerative joint disease, skin or lung cancer, gastrointestinal tract tumors, increased susceptibility to chemically-induced tumors, and impaired lung development and vascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,931,053 I329N probably benign Het
2700049A03Rik T A 12: 71,164,544 I684K possibly damaging Het
Abcg3 T A 5: 104,974,735 R97S probably benign Het
Acin1 A T 14: 54,665,416 F160L probably benign Het
Asb10 T C 5: 24,537,856 D293G probably damaging Het
Atp6v1c1 T C 15: 38,677,581 S117P probably benign Het
Bahcc1 T A 11: 120,273,009 V711E probably damaging Het
Baz2b A T 2: 59,968,776 S335T probably benign Het
Bdkrb2 C T 12: 105,591,779 A93V probably damaging Het
Cacna1d A T 14: 30,095,364 V1247D probably damaging Het
Cenpb A C 2: 131,179,624 F85V probably benign Het
Cep112 C A 11: 108,859,376 Q142K probably damaging Het
Ciita T A 16: 10,509,207 probably null Het
Cnr1 A G 4: 33,943,897 D95G probably benign Het
Ctnnd1 A T 2: 84,609,646 D767E probably benign Het
Ddx20 T C 3: 105,680,613 N384D probably damaging Het
Dnaaf3 T A 7: 4,527,533 D191V probably damaging Het
Efna1 T C 3: 89,276,388 N44D possibly damaging Het
Fam149a C A 8: 45,350,406 K349N probably damaging Het
Fbxl20 T A 11: 98,113,253 I70L possibly damaging Het
Flnb C T 14: 7,907,171 T1248I probably damaging Het
Frem2 T C 3: 53,547,688 R2156G probably damaging Het
Ftl1 T C 7: 45,459,540 Y31C probably damaging Het
Gm5862 G T 5: 26,019,348 H208N probably benign Het
Hc A T 2: 35,010,032 Y1096* probably null Het
Hps1 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 19: 42,766,725 Het
Ints3 T C 3: 90,406,334 D329G probably damaging Het
Irak3 A T 10: 120,201,365 L32Q probably damaging Het
Kif1bp T C 10: 62,566,064 T20A probably benign Het
Klrb1f A T 6: 129,053,811 D95V probably benign Het
Krt79 C T 15: 101,936,170 D260N probably benign Het
Lrp11 C A 10: 7,608,714 probably null Het
Lrrc10 C A 10: 117,045,549 R43S possibly damaging Het
Muc5b A T 7: 141,864,717 Y3800F possibly damaging Het
Myh14 T C 7: 44,629,313 K1003E probably damaging Het
Nbeal2 A G 9: 110,626,108 I2567T probably damaging Het
Necab2 G T 8: 119,467,616 R277L probably damaging Het
Nell1 T C 7: 50,701,179 Y525H probably benign Het
Olfm4 T A 14: 80,014,198 M186K probably damaging Het
Olfr389 T A 11: 73,777,069 Q86L probably benign Het
Olfr753-ps1 T C 17: 37,169,973 K225R probably benign Het
Olfr934 T C 9: 38,982,904 I47V probably benign Het
Pcdhb11 A T 18: 37,422,381 S255C possibly damaging Het
Rrbp1 A T 2: 143,974,598 C704S probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sh2d3c C T 2: 32,752,653 R552* probably null Het
Sh3d19 A G 3: 86,084,911 E82G probably benign Het
Son T A 16: 91,654,785 L140Q probably damaging Het
Svil G A 18: 5,114,682 probably benign Het
Syne1 T C 10: 5,227,912 K4854R probably benign Het
Tmem202 C A 9: 59,525,474 probably benign Het
Tmem56 T C 3: 121,207,156 D276G possibly damaging Het
Trak2 T C 1: 58,910,025 T539A probably benign Het
Trdn T C 10: 33,157,018 S80P probably damaging Het
Ugt2b37 T A 5: 87,254,600 R57S probably benign Het
Usp34 G A 11: 23,458,023 R2616Q probably damaging Het
Usp48 T C 4: 137,638,233 Y113H probably damaging Het
Vtcn1 G T 3: 100,888,163 probably null Het
Wdr19 G A 5: 65,225,334 R467Q possibly damaging Het
Wdr72 A G 9: 74,155,039 Y489C probably benign Het
Wipf1 C A 2: 73,437,404 G217W probably damaging Het
Other mutations in Errfi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Errfi1 APN 4 150867030 missense probably damaging 0.99
IGL02425:Errfi1 APN 4 150866356 missense probably benign 0.01
R1326:Errfi1 UTSW 4 150865164 missense possibly damaging 0.92
R1530:Errfi1 UTSW 4 150865386 missense probably benign 0.36
R3162:Errfi1 UTSW 4 150867359 missense probably damaging 1.00
R3162:Errfi1 UTSW 4 150867359 missense probably damaging 1.00
R4720:Errfi1 UTSW 4 150866747 missense probably damaging 1.00
R7099:Errfi1 UTSW 4 150866768 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGTTCCTTGCATCCTGCC -3'
(R):5'- AGCACCTCATAACTGCTCTAAG -3'

Sequencing Primer
(F):5'- TTATTACTTACTACCTGAGAGGCCAC -3'
(R):5'- AACTGCTCTAAGCCTTTCTCATTAAG -3'
Posted On2018-11-06