Incidental Mutation 'R6916:Wdr72'
ID539356
Institutional Source Beutler Lab
Gene Symbol Wdr72
Ensembl Gene ENSMUSG00000044976
Gene NameWD repeat domain 72
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R6916 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location74110356-74283308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74155039 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 489 (Y489C)
Ref Sequence ENSEMBL: ENSMUSP00000149349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055879] [ENSMUST00000215440]
Predicted Effect probably benign
Transcript: ENSMUST00000055879
AA Change: Y501C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057320
Gene: ENSMUSG00000044976
AA Change: Y501C

DomainStartEndE-ValueType
WD40 4 45 1.24e0 SMART
WD40 51 93 1.54e0 SMART
WD40 143 188 8.22e1 SMART
Blast:WD40 319 363 4e-19 BLAST
WD40 398 443 8.88e0 SMART
WD40 461 506 5.97e-1 SMART
WD40 509 554 9.9e0 SMART
WD40 557 596 2.12e-3 SMART
low complexity region 694 711 N/A INTRINSIC
low complexity region 780 798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000215440
AA Change: Y489C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1136 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with eight WD-40 repeats. Mutations in this gene have been associated with amelogenesis imperfecta hypomaturation type 2A3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele display hypomineralized enamel, ameloblast abnormalities and decreased post-weaning body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,931,053 I329N probably benign Het
2700049A03Rik T A 12: 71,164,544 I684K possibly damaging Het
Abcg3 T A 5: 104,974,735 R97S probably benign Het
Acin1 A T 14: 54,665,416 F160L probably benign Het
Asb10 T C 5: 24,537,856 D293G probably damaging Het
Atp6v1c1 T C 15: 38,677,581 S117P probably benign Het
Bahcc1 T A 11: 120,273,009 V711E probably damaging Het
Baz2b A T 2: 59,968,776 S335T probably benign Het
Bdkrb2 C T 12: 105,591,779 A93V probably damaging Het
Cacna1d A T 14: 30,095,364 V1247D probably damaging Het
Cenpb A C 2: 131,179,624 F85V probably benign Het
Cep112 C A 11: 108,859,376 Q142K probably damaging Het
Ciita T A 16: 10,509,207 probably null Het
Cnr1 A G 4: 33,943,897 D95G probably benign Het
Ctnnd1 A T 2: 84,609,646 D767E probably benign Het
Ddx20 T C 3: 105,680,613 N384D probably damaging Het
Dnaaf3 T A 7: 4,527,533 D191V probably damaging Het
Efna1 T C 3: 89,276,388 N44D possibly damaging Het
Errfi1 A T 4: 150,867,473 K453* probably null Het
Fam149a C A 8: 45,350,406 K349N probably damaging Het
Fbxl20 T A 11: 98,113,253 I70L possibly damaging Het
Flnb C T 14: 7,907,171 T1248I probably damaging Het
Frem2 T C 3: 53,547,688 R2156G probably damaging Het
Ftl1 T C 7: 45,459,540 Y31C probably damaging Het
Gm5862 G T 5: 26,019,348 H208N probably benign Het
Hc A T 2: 35,010,032 Y1096* probably null Het
Hps1 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 19: 42,766,725 Het
Ints3 T C 3: 90,406,334 D329G probably damaging Het
Irak3 A T 10: 120,201,365 L32Q probably damaging Het
Kif1bp T C 10: 62,566,064 T20A probably benign Het
Klrb1f A T 6: 129,053,811 D95V probably benign Het
Krt79 C T 15: 101,936,170 D260N probably benign Het
Lrp11 C A 10: 7,608,714 probably null Het
Lrrc10 C A 10: 117,045,549 R43S possibly damaging Het
Muc5b A T 7: 141,864,717 Y3800F possibly damaging Het
Myh14 T C 7: 44,629,313 K1003E probably damaging Het
Nbeal2 A G 9: 110,626,108 I2567T probably damaging Het
Necab2 G T 8: 119,467,616 R277L probably damaging Het
Nell1 T C 7: 50,701,179 Y525H probably benign Het
Olfm4 T A 14: 80,014,198 M186K probably damaging Het
Olfr389 T A 11: 73,777,069 Q86L probably benign Het
Olfr753-ps1 T C 17: 37,169,973 K225R probably benign Het
Olfr934 T C 9: 38,982,904 I47V probably benign Het
Pcdhb11 A T 18: 37,422,381 S255C possibly damaging Het
Rrbp1 A T 2: 143,974,598 C704S probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sh2d3c C T 2: 32,752,653 R552* probably null Het
Sh3d19 A G 3: 86,084,911 E82G probably benign Het
Son T A 16: 91,654,785 L140Q probably damaging Het
Svil G A 18: 5,114,682 probably benign Het
Syne1 T C 10: 5,227,912 K4854R probably benign Het
Tmem202 C A 9: 59,525,474 probably benign Het
Tmem56 T C 3: 121,207,156 D276G possibly damaging Het
Trak2 T C 1: 58,910,025 T539A probably benign Het
Trdn T C 10: 33,157,018 S80P probably damaging Het
Ugt2b37 T A 5: 87,254,600 R57S probably benign Het
Usp34 G A 11: 23,458,023 R2616Q probably damaging Het
Usp48 T C 4: 137,638,233 Y113H probably damaging Het
Vtcn1 G T 3: 100,888,163 probably null Het
Wdr19 G A 5: 65,225,334 R467Q possibly damaging Het
Wipf1 C A 2: 73,437,404 G217W probably damaging Het
Other mutations in Wdr72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Wdr72 APN 9 74155129 missense probably damaging 1.00
IGL01385:Wdr72 APN 9 74179506 splice site probably benign
IGL01512:Wdr72 APN 9 74148759 missense probably benign 0.02
IGL01544:Wdr72 APN 9 74148725 missense probably damaging 1.00
IGL01938:Wdr72 APN 9 74148774 missense probably benign 0.25
IGL02090:Wdr72 APN 9 74154930 missense possibly damaging 0.87
IGL02121:Wdr72 APN 9 74281729 utr 3 prime probably benign
IGL02140:Wdr72 APN 9 74210223 missense probably benign 0.40
IGL02171:Wdr72 APN 9 74210534 missense possibly damaging 0.94
IGL02208:Wdr72 APN 9 74157299 missense probably damaging 1.00
IGL02936:Wdr72 APN 9 74152580 missense probably damaging 1.00
IGL02979:Wdr72 APN 9 74179556 missense probably damaging 1.00
IGL03263:Wdr72 APN 9 74157429 missense probably damaging 1.00
F5770:Wdr72 UTSW 9 74157270 missense probably damaging 0.96
R0107:Wdr72 UTSW 9 74210433 missense probably damaging 1.00
R0332:Wdr72 UTSW 9 74157252 critical splice acceptor site probably null
R0420:Wdr72 UTSW 9 74210757 missense possibly damaging 0.75
R0536:Wdr72 UTSW 9 74157408 missense probably damaging 1.00
R0565:Wdr72 UTSW 9 74217306 missense probably benign 0.34
R0755:Wdr72 UTSW 9 74145094 missense probably benign 0.05
R1183:Wdr72 UTSW 9 74179585 missense probably benign 0.00
R1636:Wdr72 UTSW 9 74179625 missense probably benign 0.00
R1668:Wdr72 UTSW 9 74210162 missense probably damaging 0.99
R1687:Wdr72 UTSW 9 74210199 missense probably benign 0.13
R1813:Wdr72 UTSW 9 74276016 missense possibly damaging 0.85
R1835:Wdr72 UTSW 9 74151617 missense probably damaging 1.00
R2036:Wdr72 UTSW 9 74151594 missense probably damaging 1.00
R2113:Wdr72 UTSW 9 74145172 missense probably benign 0.07
R2331:Wdr72 UTSW 9 74148326 missense probably damaging 1.00
R2369:Wdr72 UTSW 9 74210175 missense possibly damaging 0.77
R3973:Wdr72 UTSW 9 74218697 missense probably benign
R4021:Wdr72 UTSW 9 74151593 missense probably benign 0.18
R4596:Wdr72 UTSW 9 74151605 missense probably benign 0.00
R4665:Wdr72 UTSW 9 74210024 missense probably benign 0.10
R4694:Wdr72 UTSW 9 74179555 missense probably damaging 1.00
R4894:Wdr72 UTSW 9 74210561 missense probably benign 0.00
R5027:Wdr72 UTSW 9 74145976 missense probably damaging 1.00
R5269:Wdr72 UTSW 9 74157371 missense probably damaging 1.00
R5432:Wdr72 UTSW 9 74275946 missense probably damaging 1.00
R5470:Wdr72 UTSW 9 74139699 nonsense probably null
R5717:Wdr72 UTSW 9 74148205 missense probably damaging 1.00
R5793:Wdr72 UTSW 9 74210343 missense probably benign 0.02
R5963:Wdr72 UTSW 9 74145028 missense probably damaging 1.00
R6108:Wdr72 UTSW 9 74151668 missense probably damaging 0.97
R6111:Wdr72 UTSW 9 74210325 missense probably benign 0.00
R6113:Wdr72 UTSW 9 74152641 missense probably benign 0.02
R6245:Wdr72 UTSW 9 74148223 missense probably damaging 1.00
R6469:Wdr72 UTSW 9 74213361 missense probably benign 0.15
R6726:Wdr72 UTSW 9 74152540 missense possibly damaging 0.54
R6857:Wdr72 UTSW 9 74155041 missense probably damaging 1.00
R6921:Wdr72 UTSW 9 74210646 missense probably benign
R7092:Wdr72 UTSW 9 74210472 missense probably damaging 1.00
R7104:Wdr72 UTSW 9 74148315 missense probably damaging 1.00
V7583:Wdr72 UTSW 9 74157270 missense probably damaging 0.96
X0067:Wdr72 UTSW 9 74152502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATAATCTTCTCGGCCAGCTG -3'
(R):5'- GGGCCGACAATGTGAGTATTTG -3'

Sequencing Primer
(F):5'- CCAGCTGGGTCTATGTTAAAAATGC -3'
(R):5'- TGATTACTTCTGGGAACACAGGC -3'
Posted On2018-11-06