Incidental Mutation 'R6916:Hps1'
ID539380
Institutional Source Beutler Lab
Gene Symbol Hps1
Ensembl Gene ENSMUSG00000025188
Gene NameHPS1, biogenesis of lysosomal organelles complex 3 subunit 1
Synonyms6030422N11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R6916 (G1)
Quality Score120.467
Status Not validated
Chromosome19
Chromosomal Location42755105-42779978 bp(-) (GRCm38)
Type of Mutation
DNA Base Change (assembly) ATCCTCCTCCTCCTCCTCCTCCTC to ATCCTCCTCCTCCTCCTCCTC at 42766725 bp
ZygosityHeterozygous
Amino Acid Change
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is a component of three different protein complexes termed biogenesis of lysosome-related organelles complex (BLOC)-3, BLOC4, and BLOC5. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 1. Alternative splicing results in multiple transcript variants. A pseudogene related to this gene is located on chromosome 22. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit hypopigmentation and increased bleeding time. Impaired natural killer cell function, reduced secretion of kidney lysosomal enzymes,and abnormal retinofugal neuronal projections characterize some alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,931,053 I329N probably benign Het
2700049A03Rik T A 12: 71,164,544 I684K possibly damaging Het
Abcg3 T A 5: 104,974,735 R97S probably benign Het
Acin1 A T 14: 54,665,416 F160L probably benign Het
Asb10 T C 5: 24,537,856 D293G probably damaging Het
Atp6v1c1 T C 15: 38,677,581 S117P probably benign Het
Bahcc1 T A 11: 120,273,009 V711E probably damaging Het
Baz2b A T 2: 59,968,776 S335T probably benign Het
Bdkrb2 C T 12: 105,591,779 A93V probably damaging Het
Cacna1d A T 14: 30,095,364 V1247D probably damaging Het
Cenpb A C 2: 131,179,624 F85V probably benign Het
Cep112 C A 11: 108,859,376 Q142K probably damaging Het
Ciita T A 16: 10,509,207 probably null Het
Cnr1 A G 4: 33,943,897 D95G probably benign Het
Ctnnd1 A T 2: 84,609,646 D767E probably benign Het
Ddx20 T C 3: 105,680,613 N384D probably damaging Het
Dnaaf3 T A 7: 4,527,533 D191V probably damaging Het
Efna1 T C 3: 89,276,388 N44D possibly damaging Het
Errfi1 A T 4: 150,867,473 K453* probably null Het
Fam149a C A 8: 45,350,406 K349N probably damaging Het
Fbxl20 T A 11: 98,113,253 I70L possibly damaging Het
Flnb C T 14: 7,907,171 T1248I probably damaging Het
Frem2 T C 3: 53,547,688 R2156G probably damaging Het
Ftl1 T C 7: 45,459,540 Y31C probably damaging Het
Gm5862 G T 5: 26,019,348 H208N probably benign Het
Hc A T 2: 35,010,032 Y1096* probably null Het
Ints3 T C 3: 90,406,334 D329G probably damaging Het
Irak3 A T 10: 120,201,365 L32Q probably damaging Het
Kif1bp T C 10: 62,566,064 T20A probably benign Het
Klrb1f A T 6: 129,053,811 D95V probably benign Het
Krt79 C T 15: 101,936,170 D260N probably benign Het
Lrp11 C A 10: 7,608,714 probably null Het
Lrrc10 C A 10: 117,045,549 R43S possibly damaging Het
Muc5b A T 7: 141,864,717 Y3800F possibly damaging Het
Myh14 T C 7: 44,629,313 K1003E probably damaging Het
Nbeal2 A G 9: 110,626,108 I2567T probably damaging Het
Necab2 G T 8: 119,467,616 R277L probably damaging Het
Nell1 T C 7: 50,701,179 Y525H probably benign Het
Olfm4 T A 14: 80,014,198 M186K probably damaging Het
Olfr389 T A 11: 73,777,069 Q86L probably benign Het
Olfr753-ps1 T C 17: 37,169,973 K225R probably benign Het
Olfr934 T C 9: 38,982,904 I47V probably benign Het
Pcdhb11 A T 18: 37,422,381 S255C possibly damaging Het
Rrbp1 A T 2: 143,974,598 C704S probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sh2d3c C T 2: 32,752,653 R552* probably null Het
Sh3d19 A G 3: 86,084,911 E82G probably benign Het
Son T A 16: 91,654,785 L140Q probably damaging Het
Svil G A 18: 5,114,682 probably benign Het
Syne1 T C 10: 5,227,912 K4854R probably benign Het
Tmem202 C A 9: 59,525,474 probably benign Het
Tmem56 T C 3: 121,207,156 D276G possibly damaging Het
Trak2 T C 1: 58,910,025 T539A probably benign Het
Trdn T C 10: 33,157,018 S80P probably damaging Het
Ugt2b37 T A 5: 87,254,600 R57S probably benign Het
Usp34 G A 11: 23,458,023 R2616Q probably damaging Het
Usp48 T C 4: 137,638,233 Y113H probably damaging Het
Vtcn1 G T 3: 100,888,163 probably null Het
Wdr19 G A 5: 65,225,334 R467Q possibly damaging Het
Wdr72 A G 9: 74,155,039 Y489C probably benign Het
Wipf1 C A 2: 73,437,404 G217W probably damaging Het
Other mutations in Hps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Hps1 APN 19 42771129 nonsense probably null
IGL02327:Hps1 APN 19 42756345 unclassified probably benign
IGL02488:Hps1 APN 19 42757788 unclassified probably benign
IGL03161:Hps1 APN 19 42767271 missense probably damaging 1.00
R0127:Hps1 UTSW 19 42771111 splice site probably benign
R0134:Hps1 UTSW 19 42766180 missense probably damaging 0.98
R0234:Hps1 UTSW 19 42762553 missense probably damaging 1.00
R0234:Hps1 UTSW 19 42762553 missense probably damaging 1.00
R0394:Hps1 UTSW 19 42770899 splice site probably null
R1435:Hps1 UTSW 19 42762275 missense probably benign 0.04
R1537:Hps1 UTSW 19 42759704 critical splice donor site probably null
R1616:Hps1 UTSW 19 42767185 missense probably damaging 1.00
R1860:Hps1 UTSW 19 42762449 missense probably damaging 1.00
R2014:Hps1 UTSW 19 42762512 missense probably benign 0.00
R3424:Hps1 UTSW 19 42760513 missense possibly damaging 0.75
R4472:Hps1 UTSW 19 42762496 missense probably damaging 1.00
R5476:Hps1 UTSW 19 42769602 splice site probably null
R6054:Hps1 UTSW 19 42770778 missense probably damaging 0.96
R6275:Hps1 UTSW 19 42769607 missense probably null 1.00
R6807:Hps1 UTSW 19 42770778 missense possibly damaging 0.60
R7487:Hps1 UTSW 19 42756261 missense probably damaging 1.00
Predicted Primers
Posted On2018-11-06