Incidental Mutation 'R6917:Gpatch2l'
ID539409
Institutional Source Beutler Lab
Gene Symbol Gpatch2l
Ensembl Gene ENSMUSG00000021254
Gene NameG patch domain containing 2 like
Synonyms1700020O03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6917 (G1)
Quality Score185.009
Status Validated
Chromosome12
Chromosomal Location86241858-86291784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86244184 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 47 (R47H)
Ref Sequence ENSEMBL: ENSMUSP00000152284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071106] [ENSMUST00000221368]
Predicted Effect probably damaging
Transcript: ENSMUST00000071106
AA Change: R47H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065858
Gene: ENSMUSG00000021254
AA Change: R47H

DomainStartEndE-ValueType
low complexity region 33 48 N/A INTRINSIC
low complexity region 127 135 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 413 427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000221368
AA Change: R47H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.6%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp A G 16: 56,617,321 probably null Het
Adcy2 A T 13: 68,620,757 M1084K possibly damaging Het
Ak1 A G 2: 32,631,152 Y95C possibly damaging Het
Akap6 A G 12: 53,069,168 E1018G probably null Het
Ccdc175 A G 12: 72,184,905 S27P probably damaging Het
Ddx31 C T 2: 28,892,409 T588I probably damaging Het
Dmxl1 T C 18: 49,864,148 W504R probably damaging Het
Echs1 T G 7: 140,110,011 M239L probably benign Het
Eno1b A G 18: 48,047,589 D278G probably benign Het
Eno3 A G 11: 70,661,436 T305A probably benign Het
Gm5591 T A 7: 38,522,190 S152C probably damaging Het
Gngt1 A G 6: 3,996,680 D42G probably benign Het
H2-Aa T C 17: 34,283,707 T79A probably damaging Het
Ice1 A T 13: 70,594,894 Y2116N probably damaging Het
Kdm6b A G 11: 69,406,593 M311T probably benign Het
L1td1 T C 4: 98,734,031 F277L probably benign Het
Lamp1 T C 8: 13,172,563 I249T probably damaging Het
Ldb3 G A 14: 34,555,364 A351V probably null Het
Lmo7 A G 14: 101,918,010 E996G probably damaging Het
Lsr T C 7: 30,958,296 D413G possibly damaging Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,377,844 probably benign Het
Myo7a T C 7: 98,095,763 E290G possibly damaging Het
Nos2 C T 11: 78,951,227 T735M possibly damaging Het
Olfr1335 A T 4: 118,809,129 L245H probably damaging Het
Olfr745 A G 14: 50,643,223 K314R possibly damaging Het
Olfr957 T A 9: 39,511,199 I174L probably damaging Het
Pik3c2g T C 6: 139,896,173 L768P probably benign Het
Plod2 T A 9: 92,593,770 V302D possibly damaging Het
Ptgdr A T 14: 44,858,610 V215E possibly damaging Het
Rad51d C T 11: 82,879,333 R199Q probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rtel1 ATT ATTTT 2: 181,338,277 probably null Het
Sgip1 A G 4: 102,968,191 R772G probably damaging Het
Slc19a2 C A 1: 164,261,009 T141N probably damaging Het
Sp4 G T 12: 118,299,173 N379K probably damaging Het
Thrap3 A G 4: 126,180,492 probably benign Het
Thumpd2 T G 17: 81,044,114 I293L probably benign Het
Tjp1 A G 7: 65,299,688 S1649P probably damaging Het
Tssk4 A G 14: 55,652,407 S326G probably benign Het
Txndc9 A C 1: 37,995,806 S6A probably benign Het
Uhrf1 T C 17: 56,309,574 Y131H probably damaging Het
Vnn3 A G 10: 23,865,934 D379G possibly damaging Het
Vsig2 T A 9: 37,541,449 S105T probably benign Het
Zfp445 A T 9: 122,862,294 probably null Het
Zfp654 A T 16: 64,786,471 M456K probably damaging Het
Other mutations in Gpatch2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02335:Gpatch2l APN 12 86256937 splice site probably benign
IGL02458:Gpatch2l APN 12 86288961 utr 3 prime probably benign
IGL03131:Gpatch2l APN 12 86281511 missense probably benign 0.00
R0546:Gpatch2l UTSW 12 86288848 makesense probably null
R1349:Gpatch2l UTSW 12 86260709 missense possibly damaging 0.94
R1368:Gpatch2l UTSW 12 86260665 missense possibly damaging 0.73
R1600:Gpatch2l UTSW 12 86256934 critical splice donor site probably null
R1701:Gpatch2l UTSW 12 86288952 missense probably benign 0.00
R2656:Gpatch2l UTSW 12 86288810 missense probably damaging 1.00
R3149:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3150:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3176:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3177:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3276:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R3277:Gpatch2l UTSW 12 86244315 missense possibly damaging 0.76
R4342:Gpatch2l UTSW 12 86260679 missense probably benign 0.00
R5161:Gpatch2l UTSW 12 86267176 missense probably benign 0.17
R5712:Gpatch2l UTSW 12 86244480 missense probably damaging 1.00
R6343:Gpatch2l UTSW 12 86260605 nonsense probably null
R6899:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6910:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6911:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6912:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6930:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6994:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6995:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6996:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6998:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R6999:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7000:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7001:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7002:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7003:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7010:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7011:Gpatch2l UTSW 12 86244184 missense probably damaging 1.00
R7203:Gpatch2l UTSW 12 86288937 missense probably benign 0.40
R7239:Gpatch2l UTSW 12 86260575 critical splice acceptor site probably null
R7327:Gpatch2l UTSW 12 86256872 missense probably damaging 1.00
R7419:Gpatch2l UTSW 12 86265251 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTAACATGACTGGAAGCGCAG -3'
(R):5'- AATGATGGCACTGAGAGCTG -3'

Sequencing Primer
(F):5'- AGCCGGTCTTCTCAAGCATC -3'
(R):5'- ACTGAGAGCTGGGTGCC -3'
Posted On2018-11-06