Incidental Mutation 'R6918:Parp1'
ID539426
Institutional Source Beutler Lab
Gene Symbol Parp1
Ensembl Gene ENSMUSG00000026496
Gene Namepoly (ADP-ribose) polymerase family, member 1
SynonymsAdprp, 5830444G22Rik, PARP, sPARP-1, parp-1, Adprt1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location180568924-180601254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 180588670 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 545 (V545I)
Ref Sequence ENSEMBL: ENSMUSP00000027777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027777]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027777
AA Change: V545I

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027777
Gene: ENSMUSG00000026496
AA Change: V545I

DomainStartEndE-ValueType
zf-PARP 12 90 4.73e-36 SMART
zf-PARP 116 200 3.99e-34 SMART
low complexity region 221 234 N/A INTRINSIC
PADR1 280 333 1.48e-28 SMART
low complexity region 359 378 N/A INTRINSIC
BRCT 388 467 9.62e-7 SMART
low complexity region 494 512 N/A INTRINSIC
WGR 553 633 2.36e-31 SMART
Pfam:PARP_reg 663 794 4e-54 PFAM
Pfam:PARP 797 1007 6.4e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chromatin-associated enzyme, poly(ADP-ribosyl)transferase, which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The modification is dependent on DNA and is involved in the regulation of various important cellular processes such as differentiation, proliferation, and tumor transformation and also in the regulation of the molecular events involved in the recovery of cell from DNA damage. In addition, this enzyme may be the site of mutation in Fanconi anemia, and may participate in the pathophysiology of type I diabetes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous ablation of this gene may lead to skin hyperplasia, extreme sensitivity to radiation and alkylating agents, abnormal response to xenobiotics and endogenous compounds, reduced noise-induced hearing loss, altered susceptibility to neurotoxicity,or protection against renal ischemic injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Chrna7 T A 7: 63,159,551 I76F probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Ddc A G 11: 11,819,307 V409A probably damaging Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dscaml1 A G 9: 45,430,507 H72R probably benign Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Hsd3b1 A G 3: 98,853,109 Y189H probably damaging Het
Kif1c G A 11: 70,706,987 E356K probably damaging Het
Kirrel2 A C 7: 30,450,814 C17G probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lmod2 A T 6: 24,603,595 N190Y probably benign Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Mixl1 T A 1: 180,694,678 I213F probably benign Het
Morc3 T C 16: 93,853,135 I268T probably benign Het
Mtx2 C T 2: 74,876,353 T224I probably damaging Het
Olfr893 G A 9: 38,209,652 V198M possibly damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pomt1 T A 2: 32,252,861 probably null Het
Pp2d1 G A 17: 53,515,459 T193M probably damaging Het
Prkra G T 2: 76,630,453 H300Q probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Ube2e3 A T 2: 78,920,039 K203M probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Parp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Parp1 APN 1 180589580 missense probably damaging 0.99
IGL01316:Parp1 APN 1 180592935 splice site probably benign
IGL01915:Parp1 APN 1 180598342 missense probably damaging 1.00
IGL02016:Parp1 APN 1 180598951 unclassified probably null
IGL03328:Parp1 APN 1 180599590 splice site probably benign
IGL03348:Parp1 APN 1 180577707 splice site probably benign
IGL03368:Parp1 APN 1 180580622 missense probably benign 0.01
R0541:Parp1 UTSW 1 180599051 missense probably benign 0.05
R0648:Parp1 UTSW 1 180600440 splice site probably benign
R1326:Parp1 UTSW 1 180600458 missense probably damaging 1.00
R1421:Parp1 UTSW 1 180600088 splice site probably benign
R1438:Parp1 UTSW 1 180591242 missense probably benign 0.08
R1781:Parp1 UTSW 1 180588013 missense probably benign 0.04
R1800:Parp1 UTSW 1 180600526 intron probably null
R1900:Parp1 UTSW 1 180597339 missense probably damaging 0.98
R1903:Parp1 UTSW 1 180588670 missense probably damaging 1.00
R2869:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2869:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2871:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2871:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2872:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2872:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2873:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R2874:Parp1 UTSW 1 180573665 missense probably damaging 1.00
R4342:Parp1 UTSW 1 180587329 missense probably benign 0.00
R4510:Parp1 UTSW 1 180591276 missense possibly damaging 0.59
R4511:Parp1 UTSW 1 180591276 missense possibly damaging 0.59
R4529:Parp1 UTSW 1 180591312 missense probably damaging 1.00
R4740:Parp1 UTSW 1 180589468 missense probably damaging 0.99
R4876:Parp1 UTSW 1 180569035 start codon destroyed probably null 1.00
R6666:Parp1 UTSW 1 180585951 missense probably benign
R6766:Parp1 UTSW 1 180598362 missense probably damaging 1.00
R6974:Parp1 UTSW 1 180589506 nonsense probably null
R6996:Parp1 UTSW 1 180587371 missense possibly damaging 0.46
R7034:Parp1 UTSW 1 180598252 missense possibly damaging 0.94
R7036:Parp1 UTSW 1 180598252 missense possibly damaging 0.94
R7068:Parp1 UTSW 1 180588668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACCCCAAGAGATTAGGAG -3'
(R):5'- TGAAGGTTCCTCTTGCTTCAG -3'

Sequencing Primer
(F):5'- GATATCTCCAGTCAGTGTAGCCAG -3'
(R):5'- TTGCTTCAGGCCCTGCAG -3'
Posted On2018-11-06