Incidental Mutation 'R6918:Mtx2'
ID539431
Institutional Source Beutler Lab
Gene Symbol Mtx2
Ensembl Gene ENSMUSG00000027099
Gene Namemetaxin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.867) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location74825803-74878431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74876353 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 224 (T224I)
Ref Sequence ENSEMBL: ENSMUSP00000028511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028511]
Predicted Effect probably damaging
Transcript: ENSMUST00000028511
AA Change: T224I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028511
Gene: ENSMUSG00000027099
AA Change: T224I

DomainStartEndE-ValueType
Pfam:GST_C_3 99 251 3.3e-21 PFAM
Pfam:GST_C_2 165 248 6.6e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the metaxin 2 protein from mouse, which has been shown to interact with the mitochondrial membrane protein metaxin 1. Because of this similarity, it is thought that the encoded protein is peripherally associated with the cytosolic face of the outer mitochondrial membrane, and that it is involved in the import of proteins into the mitochondrion. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Chrna7 T A 7: 63,159,551 I76F probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Ddc A G 11: 11,819,307 V409A probably damaging Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dscaml1 A G 9: 45,430,507 H72R probably benign Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Hsd3b1 A G 3: 98,853,109 Y189H probably damaging Het
Kif1c G A 11: 70,706,987 E356K probably damaging Het
Kirrel2 A C 7: 30,450,814 C17G probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lmod2 A T 6: 24,603,595 N190Y probably benign Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Mixl1 T A 1: 180,694,678 I213F probably benign Het
Morc3 T C 16: 93,853,135 I268T probably benign Het
Olfr893 G A 9: 38,209,652 V198M possibly damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Parp1 G A 1: 180,588,670 V545I possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pomt1 T A 2: 32,252,861 probably null Het
Pp2d1 G A 17: 53,515,459 T193M probably damaging Het
Prkra G T 2: 76,630,453 H300Q probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Ube2e3 A T 2: 78,920,039 K203M probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Mtx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Mtx2 APN 2 74876389 missense probably damaging 1.00
IGL03277:Mtx2 APN 2 74868404 missense probably damaging 1.00
R0593:Mtx2 UTSW 2 74869436 splice site probably benign
R0638:Mtx2 UTSW 2 74869290 splice site probably benign
R2240:Mtx2 UTSW 2 74869352 missense probably benign 0.00
R2906:Mtx2 UTSW 2 74866909 missense probably damaging 1.00
R3151:Mtx2 UTSW 2 74847290 splice site probably null
R3732:Mtx2 UTSW 2 74847262 missense probably damaging 1.00
R3732:Mtx2 UTSW 2 74847262 missense probably damaging 1.00
R3733:Mtx2 UTSW 2 74847262 missense probably damaging 1.00
R7154:Mtx2 UTSW 2 74876418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGGCACACTGGAAACC -3'
(R):5'- GATCCTGCAACTACTACCATATTGTTC -3'

Sequencing Primer
(F):5'- AAATGCTGTCAAGTTCTGAGAAG -3'
(R):5'- AGACAACCTGCCTTTACC -3'
Posted On2018-11-06