Incidental Mutation 'R6918:Prkra'
ID539432
Institutional Source Beutler Lab
Gene Symbol Prkra
Ensembl Gene ENSMUSG00000002731
Gene Nameprotein kinase, interferon inducible double stranded RNA dependent activator
Synonymslear, PRK, Pact, RAX
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.530) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location76629898-76648015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 76630453 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 300 (H300Q)
Ref Sequence ENSEMBL: ENSMUSP00000002808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002808]
Predicted Effect probably damaging
Transcript: ENSMUST00000002808
AA Change: H300Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002808
Gene: ENSMUSG00000002731
AA Change: H300Q

DomainStartEndE-ValueType
DSRM 35 100 4.63e-24 SMART
DSRM 127 193 2.23e-17 SMART
DSRM 241 307 1.16e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein kinase activated by double-stranded RNA which mediates the effects of interferon in response to viral infection. Mutations in this gene have been associated with dystonia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a deletion of the entire gene show embryonic lethality prior to implantation. Mice homozygous for a deletion in the last exon are viable but exhibit small size, turbinate hypoplasia, short snout, severe microtia, outer and middle ear defects, and impaired hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Chrna7 T A 7: 63,159,551 I76F probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Ddc A G 11: 11,819,307 V409A probably damaging Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dscaml1 A G 9: 45,430,507 H72R probably benign Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Hsd3b1 A G 3: 98,853,109 Y189H probably damaging Het
Kif1c G A 11: 70,706,987 E356K probably damaging Het
Kirrel2 A C 7: 30,450,814 C17G probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lmod2 A T 6: 24,603,595 N190Y probably benign Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Mixl1 T A 1: 180,694,678 I213F probably benign Het
Morc3 T C 16: 93,853,135 I268T probably benign Het
Mtx2 C T 2: 74,876,353 T224I probably damaging Het
Olfr893 G A 9: 38,209,652 V198M possibly damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Parp1 G A 1: 180,588,670 V545I possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pomt1 T A 2: 32,252,861 probably null Het
Pp2d1 G A 17: 53,515,459 T193M probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Ube2e3 A T 2: 78,920,039 K203M probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Prkra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Prkra APN 2 76630436 missense probably damaging 1.00
IGL02016:Prkra APN 2 76643309 splice site probably null
IGL02823:Prkra APN 2 76630424 missense probably damaging 1.00
IGL02962:Prkra APN 2 76633547 missense probably damaging 1.00
IGL03265:Prkra APN 2 76640270 missense probably benign 0.06
R1520:Prkra UTSW 2 76639278 missense possibly damaging 0.62
R1609:Prkra UTSW 2 76633592 missense probably benign 0.06
R1751:Prkra UTSW 2 76647240 missense possibly damaging 0.63
R1767:Prkra UTSW 2 76647240 missense possibly damaging 0.63
R2131:Prkra UTSW 2 76647136 missense probably damaging 1.00
R5288:Prkra UTSW 2 76639278 missense probably damaging 0.99
R5385:Prkra UTSW 2 76639278 missense probably damaging 0.99
R5386:Prkra UTSW 2 76639278 missense probably damaging 0.99
R6802:Prkra UTSW 2 76633537 missense probably damaging 1.00
R7445:Prkra UTSW 2 76633598 missense probably benign 0.25
R7471:Prkra UTSW 2 76647201 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAATCTGGAAAGTTGACGGAATCTG -3'
(R):5'- AGTGTGCTGTGGATACTTCAAG -3'

Sequencing Primer
(F):5'- TTGACGGAATCTGAAGAGATTTGG -3'
(R):5'- GTGCTGTGGATACTTCAAGACCAATG -3'
Posted On2018-11-06