Incidental Mutation 'R6918:Kirrel2'
ID539443
Institutional Source Beutler Lab
Gene Symbol Kirrel2
Ensembl Gene ENSMUSG00000036915
Gene Namekirre like nephrin family adhesion molecule 2
SynonymsC330019F22Rik, NEPH3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30447534-30457690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30450814 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 17 (C17G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045817]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045817
AA Change: C530G

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039395
Gene: ENSMUSG00000036915
AA Change: C530G

DomainStartEndE-ValueType
IG 27 117 9.18e-12 SMART
IG 128 219 5.13e-1 SMART
IG_like 230 306 8.06e0 SMART
IGc2 321 379 3.06e-8 SMART
IG_like 401 500 4.65e1 SMART
transmembrane domain 509 531 N/A INTRINSIC
low complexity region 547 565 N/A INTRINSIC
low complexity region 607 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169893
SMART Domains Protein: ENSMUSP00000131161
Gene: ENSMUSG00000036915

DomainStartEndE-ValueType
IG 27 117 9.18e-12 SMART
IG_like 118 189 5.91e-1 SMART
IG_like 211 287 8.06e0 SMART
IGc2 302 360 3.06e-8 SMART
IG_like 382 481 4.65e1 SMART
transmembrane domain 490 512 N/A INTRINSIC
low complexity region 528 546 N/A INTRINSIC
low complexity region 588 610 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170152
AA Change: C17G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132652
Gene: ENSMUSG00000036915
AA Change: C17G

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 82 104 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane protein and member of the immunoglobulin superfamily of cell adhesion molecules. The encoded protein localizes to adherens junctions in pancreatic beta cells and regulates insulin secretion. Autoantibodies against the encoded protein have been detected in serum from patients with type 1 diabetes. This gene may also play a role in glomerular development and decreased expression of this gene has been observed in human glomerular diseases. This gene and the related opposite-strand gene nephrin (GeneID: 527362) are regulated by a bidirectional promoter. [provided by RefSeq, Jul 2016]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Chrna7 T A 7: 63,159,551 I76F probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Ddc A G 11: 11,819,307 V409A probably damaging Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dscaml1 A G 9: 45,430,507 H72R probably benign Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Hsd3b1 A G 3: 98,853,109 Y189H probably damaging Het
Kif1c G A 11: 70,706,987 E356K probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lmod2 A T 6: 24,603,595 N190Y probably benign Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Mixl1 T A 1: 180,694,678 I213F probably benign Het
Morc3 T C 16: 93,853,135 I268T probably benign Het
Mtx2 C T 2: 74,876,353 T224I probably damaging Het
Olfr893 G A 9: 38,209,652 V198M possibly damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Parp1 G A 1: 180,588,670 V545I possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pomt1 T A 2: 32,252,861 probably null Het
Pp2d1 G A 17: 53,515,459 T193M probably damaging Het
Prkra G T 2: 76,630,453 H300Q probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Ube2e3 A T 2: 78,920,039 K203M probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Kirrel2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02162:Kirrel2 APN 7 30453664 missense probably benign 0.03
IGL02457:Kirrel2 APN 7 30452740 missense probably damaging 1.00
IGL02609:Kirrel2 APN 7 30448340 missense probably benign 0.00
R0029:Kirrel2 UTSW 7 30453165 unclassified probably benign
R0395:Kirrel2 UTSW 7 30450458 missense possibly damaging 0.68
R0987:Kirrel2 UTSW 7 30448130 missense probably damaging 1.00
R1511:Kirrel2 UTSW 7 30456498 missense probably damaging 1.00
R2226:Kirrel2 UTSW 7 30454154 missense probably damaging 1.00
R4818:Kirrel2 UTSW 7 30449868 missense probably benign 0.32
R4963:Kirrel2 UTSW 7 30450801 critical splice donor site probably null
R6985:Kirrel2 UTSW 7 30455306 missense probably damaging 1.00
R6995:Kirrel2 UTSW 7 30455179 missense probably damaging 1.00
R7014:Kirrel2 UTSW 7 30454574 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGATAAGATGAGCCCATGC -3'
(R):5'- GCTGCCCACACTGTATACAC -3'

Sequencing Primer
(F):5'- TGAGCCCATGCAAGCATTG -3'
(R):5'- AGACTTGCTGCCCACTGTACAC -3'
Posted On2018-11-06