Incidental Mutation 'R6918:Dscaml1'
ID539449
Institutional Source Beutler Lab
Gene Symbol Dscaml1
Ensembl Gene ENSMUSG00000032087
Gene NameDS cell adhesion molecule like 1
Synonyms4921507G06Rik, 4930435C18Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081270; MGI: 2150309

Is this an essential gene? Possibly essential (E-score: 0.663) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location45426628-45753712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45430507 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 72 (H72R)
Ref Sequence ENSEMBL: ENSMUSP00000034592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034592] [ENSMUST00000213919] [ENSMUST00000217538]
Predicted Effect probably benign
Transcript: ENSMUST00000034592
AA Change: H72R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034592
Gene: ENSMUSG00000032087
AA Change: H72R

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 28 55 N/A INTRINSIC
IG_like 96 168 1.22e0 SMART
IG 189 277 1.15e-3 SMART
IGc2 296 359 2.54e-14 SMART
IGc2 385 451 8.12e-13 SMART
IGc2 478 550 9.55e-10 SMART
IGc2 575 640 9.78e-7 SMART
IGc2 666 734 5.93e-6 SMART
IGc2 760 832 6.75e-10 SMART
IG 853 943 1e-3 SMART
FN3 945 1029 6.64e-7 SMART
FN3 1045 1133 9.46e-12 SMART
FN3 1148 1234 3.2e-9 SMART
FN3 1249 1332 3.48e-10 SMART
IGc2 1363 1428 1.49e-11 SMART
FN3 1442 1522 3.42e-9 SMART
FN3 1537 1618 2.14e-1 SMART
low complexity region 1671 1683 N/A INTRINSIC
low complexity region 2018 2026 N/A INTRINSIC
low complexity region 2035 2069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213919
Predicted Effect probably benign
Transcript: ENSMUST00000217538
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ig superfamily of cell adhesion molecules and is involved in neuronal differentiation. The encoded membrane-bound protein localizes to the cell surface, where it forms aggregates that repel neuronal processes of the same cell type. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired self-avoidance in multiple cell types in the retina. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Chrna7 T A 7: 63,159,551 I76F probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Ddc A G 11: 11,819,307 V409A probably damaging Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Hsd3b1 A G 3: 98,853,109 Y189H probably damaging Het
Kif1c G A 11: 70,706,987 E356K probably damaging Het
Kirrel2 A C 7: 30,450,814 C17G probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lmod2 A T 6: 24,603,595 N190Y probably benign Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Mixl1 T A 1: 180,694,678 I213F probably benign Het
Morc3 T C 16: 93,853,135 I268T probably benign Het
Mtx2 C T 2: 74,876,353 T224I probably damaging Het
Olfr893 G A 9: 38,209,652 V198M possibly damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Parp1 G A 1: 180,588,670 V545I possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pomt1 T A 2: 32,252,861 probably null Het
Pp2d1 G A 17: 53,515,459 T193M probably damaging Het
Prkra G T 2: 76,630,453 H300Q probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Ube2e3 A T 2: 78,920,039 K203M probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Dscaml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dscaml1 APN 9 45670200 nonsense probably null
IGL00497:Dscaml1 APN 9 45752238 missense probably damaging 1.00
IGL00895:Dscaml1 APN 9 45751253 missense probably damaging 0.99
IGL01011:Dscaml1 APN 9 45683672 missense possibly damaging 0.76
IGL01086:Dscaml1 APN 9 45702662 splice site probably benign
IGL01125:Dscaml1 APN 9 45749632 critical splice acceptor site probably null
IGL01132:Dscaml1 APN 9 45752328 nonsense probably null
IGL01356:Dscaml1 APN 9 45746857 missense probably benign 0.03
IGL01459:Dscaml1 APN 9 45742683 nonsense probably null
IGL01552:Dscaml1 APN 9 45447908 missense probably damaging 1.00
IGL02033:Dscaml1 APN 9 45683782 missense probably damaging 1.00
IGL02044:Dscaml1 APN 9 45746943 nonsense probably null
IGL02095:Dscaml1 APN 9 45447703 missense probably damaging 1.00
IGL02166:Dscaml1 APN 9 45683701 missense probably damaging 0.98
IGL02262:Dscaml1 APN 9 45745116 missense probably benign
IGL02262:Dscaml1 APN 9 45732080 missense probably benign 0.44
IGL02340:Dscaml1 APN 9 45670176 missense possibly damaging 0.66
IGL02604:Dscaml1 APN 9 45744328 unclassified probably benign
IGL02619:Dscaml1 APN 9 45447796 missense probably damaging 1.00
IGL02805:Dscaml1 APN 9 45447897 missense probably damaging 0.98
IGL03409:Dscaml1 APN 9 45670103 missense probably damaging 1.00
D3080:Dscaml1 UTSW 9 45684325 missense probably benign 0.44
IGL03050:Dscaml1 UTSW 9 45742999 missense probably damaging 1.00
R0149:Dscaml1 UTSW 9 45742680 nonsense probably null
R0582:Dscaml1 UTSW 9 45668264 missense possibly damaging 0.77
R0629:Dscaml1 UTSW 9 45721418 missense probably damaging 0.98
R0632:Dscaml1 UTSW 9 45732134 missense probably benign 0.06
R0815:Dscaml1 UTSW 9 45745074 missense probably benign 0.00
R1162:Dscaml1 UTSW 9 45752349 splice site probably benign
R1449:Dscaml1 UTSW 9 45742223 missense possibly damaging 0.95
R1474:Dscaml1 UTSW 9 45685221 missense probably damaging 1.00
R1481:Dscaml1 UTSW 9 45672643 missense probably benign 0.01
R1533:Dscaml1 UTSW 9 45450584 missense probably damaging 0.99
R1542:Dscaml1 UTSW 9 45749440 missense possibly damaging 0.84
R1572:Dscaml1 UTSW 9 45721333 missense probably benign 0.00
R1627:Dscaml1 UTSW 9 45753147 missense probably damaging 1.00
R1634:Dscaml1 UTSW 9 45672749 missense probably damaging 1.00
R1713:Dscaml1 UTSW 9 45752690 missense possibly damaging 0.49
R1777:Dscaml1 UTSW 9 45683756 missense possibly damaging 0.58
R1812:Dscaml1 UTSW 9 45751286 critical splice donor site probably null
R1834:Dscaml1 UTSW 9 45683632 missense probably benign 0.00
R1907:Dscaml1 UTSW 9 45740480 missense probably damaging 1.00
R1953:Dscaml1 UTSW 9 45670224 missense probably benign 0.01
R2056:Dscaml1 UTSW 9 45750132 missense probably damaging 0.99
R2193:Dscaml1 UTSW 9 45685234 missense probably benign 0.21
R2497:Dscaml1 UTSW 9 45745078 missense probably benign 0.00
R3768:Dscaml1 UTSW 9 45732137 missense possibly damaging 0.94
R3891:Dscaml1 UTSW 9 45717484 missense possibly damaging 0.84
R4110:Dscaml1 UTSW 9 45732068 missense probably benign 0.07
R4706:Dscaml1 UTSW 9 45450580 missense probably damaging 1.00
R4716:Dscaml1 UTSW 9 45450592 missense probably damaging 1.00
R4719:Dscaml1 UTSW 9 45672695 missense probably benign 0.13
R4770:Dscaml1 UTSW 9 45670106 missense probably damaging 1.00
R4924:Dscaml1 UTSW 9 45745189 missense probably damaging 1.00
R5167:Dscaml1 UTSW 9 45717432 missense probably damaging 1.00
R5346:Dscaml1 UTSW 9 45450559 missense possibly damaging 0.63
R5737:Dscaml1 UTSW 9 45745185 missense probably damaging 0.99
R5977:Dscaml1 UTSW 9 45721298 missense probably benign 0.19
R6073:Dscaml1 UTSW 9 45450583 missense probably benign 0.22
R6276:Dscaml1 UTSW 9 45668160 missense possibly damaging 0.62
R6415:Dscaml1 UTSW 9 45683677 nonsense probably null
R6527:Dscaml1 UTSW 9 45712184 nonsense probably null
R6582:Dscaml1 UTSW 9 45752806 missense probably benign 0.00
R6655:Dscaml1 UTSW 9 45746937 missense probably benign 0.00
R6772:Dscaml1 UTSW 9 45710311 missense probably damaging 1.00
R6799:Dscaml1 UTSW 9 45450583 missense probably benign 0.22
R6892:Dscaml1 UTSW 9 45683830 missense probably damaging 0.99
R6967:Dscaml1 UTSW 9 45674523 missense probably damaging 0.97
R7214:Dscaml1 UTSW 9 45670139 missense probably benign 0.01
R7286:Dscaml1 UTSW 9 45742746 critical splice donor site probably null
R7315:Dscaml1 UTSW 9 45745125 missense probably benign 0.00
R7338:Dscaml1 UTSW 9 45674504 missense probably benign 0.12
R7343:Dscaml1 UTSW 9 45752916 missense probably benign
R7395:Dscaml1 UTSW 9 45702405 missense possibly damaging 0.73
R7439:Dscaml1 UTSW 9 45710326 missense possibly damaging 0.94
X0058:Dscaml1 UTSW 9 45752128 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTTGTGGGACTAAGTGAC -3'
(R):5'- AAACCAGGGGTTCCTTTGCC -3'

Sequencing Primer
(F):5'- ACTAAGTGACCCCAGGCTG -3'
(R):5'- GTCCCAGGCTGACTCTCAC -3'
Posted On2018-11-06